\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909749678:

Variant ID: vg0909749678 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9749678
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCAAGATTCAAAATCTCAGTTAGGAAGGCTCAAAAGGGAAAATATCCATTTGCTAACAAGATTGATGTGTAGATGACTTGGTAAAGATACGTGCATGTG[A/G]
GGTAGAGTCTCAAGTTCAAATCCTATCAATTTGAAGAGTCATATACAACTTGTATAAATAGATATTTGTGGTTGGGGCTTTGTATATACATGAGTACAGA

Reverse complement sequence

TCTGTACTCATGTATATACAAAGCCCCAACCACAAATATCTATTTATACAAGTTGTATATGACTCTTCAAATTGATAGGATTTGAACTTGAGACTCTACC[T/C]
CACATGCACGTATCTTTACCAAGTCATCTACACATCAATCTTGTTAGCAAATGGATATTTTCCCTTTTGAGCCTTCCTAACTGAGATTTTGAATCTTGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 5.70% 0.57% 26.15% NA
All Indica  2759 74.80% 0.20% 0.36% 24.65% NA
All Japonica  1512 61.80% 16.80% 0.99% 20.37% NA
Aus  269 30.50% 1.50% 0.00% 68.03% NA
Indica I  595 82.70% 0.30% 0.84% 16.13% NA
Indica II  465 75.90% 0.00% 0.22% 23.87% NA
Indica III  913 68.70% 0.00% 0.44% 30.89% NA
Indica Intermediate  786 75.20% 0.50% 0.00% 24.30% NA
Temperate Japonica  767 81.10% 0.80% 0.78% 17.34% NA
Tropical Japonica  504 29.00% 45.40% 1.39% 24.21% NA
Japonica Intermediate  241 69.30% 7.90% 0.83% 21.99% NA
VI/Aromatic  96 56.20% 0.00% 0.00% 43.75% NA
Intermediate  90 64.40% 7.80% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909749678 A -> G LOC_Os09g15960.1 downstream_gene_variant ; 3341.0bp to feature; MODIFIER silent_mutation Average:38.149; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N
vg0909749678 A -> G LOC_Os09g15950.1 intron_variant ; MODIFIER silent_mutation Average:38.149; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N
vg0909749678 A -> DEL N N silent_mutation Average:38.149; most accessible tissue: Zhenshan97 young leaf, score: 87.443 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0909749678 A G 0.03 0.04 0.03 0.01 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909749678 NA 1.18E-08 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 2.91E-11 mr1082 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 1.91E-06 2.12E-11 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 9.89E-06 5.58E-07 mr1103 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 6.39E-06 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 6.79E-06 6.79E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 4.08E-10 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 4.32E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 2.36E-07 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 4.23E-06 3.59E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 1.83E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 3.21E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 1.05E-06 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 2.83E-07 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 7.71E-06 7.71E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 9.57E-08 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 4.29E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 7.50E-06 3.08E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 5.75E-09 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909749678 NA 1.29E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251