Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909518112:

Variant ID: vg0909518112 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 9518112
Reference Allele: GGAAlternative Allele: G,GGAGA,AGA,GGAGAGA,GAGA
Primary Allele: GGASecondary Allele: GGAGA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCCCTCATCTTGAACTCCGCTTCCTACAACCGGTCGTCGCCTCGTTGCCCCCATCCAACTACTGGAGAGAGGGAGAGAGGAGGGGAGAGGAACGAGGG[GGA/G,GGAGA,AGA,GGAGAGA,GAGA]
GAGAGAGAGAGAGAGGAGAAAAGAGATGACAGACTCCTCCACTCTGGTCAAGGACCATTGCCGCCAGACTTCCGTCGGCGTGGCCCCGTCTCCACCACCG

Reverse complement sequence

CGGTGGTGGAGACGGGGCCACGCCGACGGAAGTCTGGCGGCAATGGTCCTTGACCAGAGTGGAGGAGTCTGTCATCTCTTTTCTCCTCTCTCTCTCTCTC[TCC/C,TCTCC,TCT,TCTCTCC,TCTC]
CCCTCGTTCCTCTCCCCTCCTCTCTCCCTCTCTCCAGTAGTTGGATGGGGGCAACGAGGCGACGACCGGTTGTAGGAAGCGGAGTTCAAGATGAGGGCTG

Allele Frequencies:

Populations Population SizeFrequency of GGA(primary allele) Frequency of GGAGA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.90% 13.50% 2.45% 3.75% G: 3.51%; AGA: 1.46%; GGAGAGA: 0.28%; GAGA: 0.08%
All Indica  2759 82.20% 14.20% 1.16% 1.99% G: 0.40%; GGAGAGA: 0.07%; AGA: 0.04%
All Japonica  1512 69.90% 10.50% 4.96% 0.00% G: 9.66%; AGA: 4.50%; GAGA: 0.26%; GGAGAGA: 0.20%
Aus  269 21.90% 31.60% 1.86% 43.49% G: 0.74%; GGAGAGA: 0.37%
Indica I  595 90.40% 6.70% 2.52% 0.00% G: 0.17%; GGAGAGA: 0.17%
Indica II  465 74.80% 18.30% 1.29% 5.16% G: 0.43%
Indica III  913 83.80% 15.70% 0.11% 0.33% G: 0.11%
Indica Intermediate  786 78.40% 15.60% 1.27% 3.56% G: 0.89%; AGA: 0.13%; GGAGAGA: 0.13%
Temperate Japonica  767 65.70% 11.30% 6.26% 0.00% G: 8.74%; AGA: 7.30%; GAGA: 0.52%; GGAGAGA: 0.13%
Tropical Japonica  504 85.30% 6.70% 2.18% 0.00% G: 5.16%; AGA: 0.40%; GGAGAGA: 0.20%
Japonica Intermediate  241 51.00% 15.80% 6.64% 0.00% G: 21.99%; AGA: 4.15%; GGAGAGA: 0.41%
VI/Aromatic  96 84.40% 0.00% 2.08% 1.04% GGAGAGA: 7.29%; G: 5.21%
Intermediate  90 85.60% 5.60% 2.22% 4.44% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909518112 GGA -> DEL N N silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GGAGAGA LOC_Os09g15570.1 upstream_gene_variant ; 4990.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GGAGAGA LOC_Os09g15580.1 upstream_gene_variant ; 768.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GGAGAGA LOC_Os09g15590.1 upstream_gene_variant ; 369.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GGAGAGA LOC_Os09g15580-LOC_Os09g15590 intergenic_region ; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GGAGA LOC_Os09g15570.1 upstream_gene_variant ; 4990.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GGAGA LOC_Os09g15580.1 upstream_gene_variant ; 768.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GGAGA LOC_Os09g15590.1 upstream_gene_variant ; 369.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GGAGA LOC_Os09g15580-LOC_Os09g15590 intergenic_region ; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GAGA LOC_Os09g15570.1 upstream_gene_variant ; 4988.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GAGA LOC_Os09g15580.1 upstream_gene_variant ; 766.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GAGA LOC_Os09g15590.1 upstream_gene_variant ; 371.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> GAGA LOC_Os09g15580-LOC_Os09g15590 intergenic_region ; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> AGA LOC_Os09g15570.1 upstream_gene_variant ; 4987.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> AGA LOC_Os09g15580.1 upstream_gene_variant ; 765.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> AGA LOC_Os09g15590.1 upstream_gene_variant ; 372.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> AGA LOC_Os09g15580-LOC_Os09g15590 intergenic_region ; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> G LOC_Os09g15570.1 upstream_gene_variant ; 4988.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> G LOC_Os09g15580.1 upstream_gene_variant ; 766.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> G LOC_Os09g15590.1 upstream_gene_variant ; 371.0bp to feature; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N
vg0909518112 GGA -> G LOC_Os09g15580-LOC_Os09g15590 intergenic_region ; MODIFIER silent_mutation Average:88.061; most accessible tissue: Zhenshan97 young leaf, score: 94.763 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0909518112 GGA AGA 0.0 0.0 0.0 0.0 0.0 0.0
vg0909518112 GGA G -0.04 -0.01 -0.03 -0.01 -0.01 0.02
vg0909518112 GGA GAGA -0.01 -0.03 -0.01 -0.04 -0.01 0.0
vg0909518112 GGA GGAGA 0.04 0.03 -0.01 0.0 0.01 0.04
vg0909518112 GGA GGAGA* 0.12 0.11 0.08 0.07 0.09 0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909518112 NA 4.57E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0909518112 2.80E-06 2.80E-06 mr1924 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909518112 6.03E-06 4.98E-10 mr1549_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909518112 NA 2.14E-08 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251