\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909402515:

Variant ID: vg0909402515 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9402515
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCGTTGACTTATTCATGACGTTTGATTATTCATCTTATTTAAAAATTTAGTGTAAATACTATAAGTGTTGGAGAAACAGGAACTGGGGTCCCATTCCTC[C/T]
GGGGCCTAGGACACCGTCAGCCTACAAGATCACTTTCTATCACATATATAATTCATTGCTAGGTCAGAAACCACGGAGGTGGAAGATGATAGCTAGCGTA

Reverse complement sequence

TACGCTAGCTATCATCTTCCACCTCCGTGGTTTCTGACCTAGCAATGAATTATATATGTGATAGAAAGTGATCTTGTAGGCTGACGGTGTCCTAGGCCCC[G/A]
GAGGAATGGGACCCCAGTTCCTGTTTCTCCAACACTTATAGTATTTACACTAAATTTTTAAATAAGATGAATAATCAAACGTCATGAATAAGTCAACGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.60% 4.20% 0.78% 64.47% NA
All Indica  2759 7.50% 2.40% 1.01% 89.05% NA
All Japonica  1512 73.00% 0.00% 0.26% 26.72% NA
Aus  269 14.10% 47.60% 0.00% 38.29% NA
Indica I  595 10.40% 0.00% 1.18% 88.40% NA
Indica II  465 3.70% 6.50% 1.29% 88.60% NA
Indica III  913 9.10% 0.50% 0.66% 89.70% NA
Indica Intermediate  786 5.90% 3.90% 1.15% 89.06% NA
Temperate Japonica  767 79.40% 0.00% 0.00% 20.60% NA
Tropical Japonica  504 70.80% 0.00% 0.79% 28.37% NA
Japonica Intermediate  241 57.30% 0.00% 0.00% 42.74% NA
VI/Aromatic  96 49.00% 0.00% 0.00% 51.04% NA
Intermediate  90 53.30% 3.30% 5.56% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909402515 C -> DEL N N silent_mutation Average:11.481; most accessible tissue: Callus, score: 74.953 N N N N
vg0909402515 C -> T LOC_Os09g15365.1 upstream_gene_variant ; 4709.0bp to feature; MODIFIER silent_mutation Average:11.481; most accessible tissue: Callus, score: 74.953 N N N N
vg0909402515 C -> T LOC_Os09g15380.1 upstream_gene_variant ; 2524.0bp to feature; MODIFIER silent_mutation Average:11.481; most accessible tissue: Callus, score: 74.953 N N N N
vg0909402515 C -> T LOC_Os09g15370.1 downstream_gene_variant ; 83.0bp to feature; MODIFIER silent_mutation Average:11.481; most accessible tissue: Callus, score: 74.953 N N N N
vg0909402515 C -> T LOC_Os09g15370-LOC_Os09g15380 intergenic_region ; MODIFIER silent_mutation Average:11.481; most accessible tissue: Callus, score: 74.953 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909402515 NA 3.83E-07 mr1054 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 2.27E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 2.95E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 7.82E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 1.11E-06 mr1287 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 8.96E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 1.33E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 5.48E-07 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 1.45E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 6.54E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 8.82E-06 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 2.47E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 7.85E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 9.82E-07 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515 NA 9.97E-11 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251