Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0909402515:

Variant ID: vg0909402515 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9402515
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCGTTGACTTATTCATGACGTTTGATTATTCATCTTATTTAAAAATTTAGTGTAAATACTATAAGTGTTGGAGAAACAGGAACTGGGGTCCCATTCCTC[C/T]
GGGGCCTAGGACACCGTCAGCCTACAAGATCACTTTCTATCACATATATAATTCATTGCTAGGTCAGAAACCACGGAGGTGGAAGATGATAGCTAGCGTA

Reverse complement sequence

TACGCTAGCTATCATCTTCCACCTCCGTGGTTTCTGACCTAGCAATGAATTATATATGTGATAGAAAGTGATCTTGTAGGCTGACGGTGTCCTAGGCCCC[G/A]
GAGGAATGGGACCCCAGTTCCTGTTTCTCCAACACTTATAGTATTTACACTAAATTTTTAAATAAGATGAATAATCAAACGTCATGAATAAGTCAACGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.60%	4.20%	0.78%	64.47%	NA
All Indica	2759	7.50%	2.40%	1.01%	89.05%	NA
All Japonica	1512	73.00%	0.00%	0.26%	26.72%	NA
Aus	269	14.10%	47.60%	0.00%	38.29%	NA
Indica I	595	10.40%	0.00%	1.18%	88.40%	NA
Indica II	465	3.70%	6.50%	1.29%	88.60%	NA
Indica III	913	9.10%	0.50%	0.66%	89.70%	NA
Indica Intermediate	786	5.90%	3.90%	1.15%	89.06%	NA
Temperate Japonica	767	79.40%	0.00%	0.00%	20.60%	NA
Tropical Japonica	504	70.80%	0.00%	0.79%	28.37%	NA
Japonica Intermediate	241	57.30%	0.00%	0.00%	42.74%	NA
VI/Aromatic	96	49.00%	0.00%	0.00%	51.04%	NA
Intermediate	90	53.30%	3.30%	5.56%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909402515	C -> DEL	N	N	silent_mutation	Average:11.481; most accessible tissue: Callus, score: 74.953	N	N	N	N
vg0909402515	C -> T	LOC_Os09g15365.1	upstream_gene_variant ; 4709.0bp to feature; MODIFIER	silent_mutation	Average:11.481; most accessible tissue: Callus, score: 74.953	N	N	N	N
vg0909402515	C -> T	LOC_Os09g15380.1	upstream_gene_variant ; 2524.0bp to feature; MODIFIER	silent_mutation	Average:11.481; most accessible tissue: Callus, score: 74.953	N	N	N	N
vg0909402515	C -> T	LOC_Os09g15370.1	downstream_gene_variant ; 83.0bp to feature; MODIFIER	silent_mutation	Average:11.481; most accessible tissue: Callus, score: 74.953	N	N	N	N
vg0909402515	C -> T	LOC_Os09g15370-LOC_Os09g15380	intergenic_region ; MODIFIER	silent_mutation	Average:11.481; most accessible tissue: Callus, score: 74.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909402515	NA	3.83E-07	mr1054	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	2.27E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	2.95E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	7.82E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	1.11E-06	mr1287	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	8.96E-06	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	1.33E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	5.48E-07	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	1.45E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	6.54E-06	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	8.82E-06	mr1500	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	2.47E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	7.85E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	9.82E-07	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909402515	NA	9.97E-11	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251