\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0909394179:

Variant ID: vg0909394179 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 9394179
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


GTAACACATATGGATGTTTGTTTTTTTCTTTTTTTTCTTTTCGGACAAATATTTGTTTATCATAGGAATAGGGCGTGCGTATTTGTATTCATAATGTGCG[T/A]
CCGCACGCATTTATATGAGCTCATGTGATTGCCTTTTAAATTGTTAGTAAAAAAAGTATTTTTAAAAATTTGACAGGAAGAGGGTGGAGCAACGGGTGGC

Reverse complement sequence

GCCACCCGTTGCTCCACCCTCTTCCTGTCAAATTTTTAAAAATACTTTTTTTACTAACAATTTAAAAGGCAATCACATGAGCTCATATAAATGCGTGCGG[A/T]
CGCACATTATGAATACAAATACGCACGCCCTATTCCTATGATAAACAAATATTTGTCCGAAAAGAAAAAAAAGAAAAAAACAAACATCCATATGTGTTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.50% 17.80% 4.32% 39.36% NA
All Indica  2759 12.30% 29.40% 3.12% 55.20% NA
All Japonica  1512 71.80% 1.50% 6.75% 19.91% NA
Aus  269 90.70% 0.00% 4.09% 5.20% NA
Indica I  595 9.40% 27.60% 3.36% 59.66% NA
Indica II  465 10.10% 21.10% 0.86% 67.96% NA
Indica III  913 14.60% 39.10% 3.61% 42.72% NA
Indica Intermediate  786 13.00% 24.60% 3.69% 58.78% NA
Temperate Japonica  767 77.30% 1.40% 6.39% 14.86% NA
Tropical Japonica  504 69.80% 1.00% 2.98% 26.19% NA
Japonica Intermediate  241 58.50% 2.90% 15.77% 22.82% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 66.70% 7.80% 5.56% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0909394179 T -> DEL N N silent_mutation Average:14.85; most accessible tissue: Callus, score: 37.906 N N N N
vg0909394179 T -> A LOC_Os09g15360.1 upstream_gene_variant ; 2777.0bp to feature; MODIFIER silent_mutation Average:14.85; most accessible tissue: Callus, score: 37.906 N N N N
vg0909394179 T -> A LOC_Os09g15370.1 upstream_gene_variant ; 4933.0bp to feature; MODIFIER silent_mutation Average:14.85; most accessible tissue: Callus, score: 37.906 N N N N
vg0909394179 T -> A LOC_Os09g15365.1 downstream_gene_variant ; 3327.0bp to feature; MODIFIER silent_mutation Average:14.85; most accessible tissue: Callus, score: 37.906 N N N N
vg0909394179 T -> A LOC_Os09g15360-LOC_Os09g15365 intergenic_region ; MODIFIER silent_mutation Average:14.85; most accessible tissue: Callus, score: 37.906 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0909394179 3.19E-06 5.81E-09 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179 2.26E-06 1.54E-12 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179 NA 5.22E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179 3.44E-07 1.89E-06 mr1545_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179 2.40E-07 4.13E-15 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909394179 5.94E-06 1.04E-14 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251