\
| Variant ID: vg0909288154 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 9288154 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGATGACATATATATAGGAGATGCATCTGTCAAACTACTAGAAAACTGATCTTTGCAGGGTTGGCCGAAAACTACAATAGTTCCGGTTCCAATAAAAACC[G/A]
GGACAAAAAAATAATTTTTAGTCCCGATTAAAAGCTATGTAATCTTTATTACCAACCGGGACTAAAGATCATCCTATGTTAGTGGCCTGTCGGTGGGCCG
CGGCCCACCGACAGGCCACTAACATAGGATGATCTTTAGTCCCGGTTGGTAATAAAGATTACATAGCTTTTAATCGGGACTAAAAATTATTTTTTTGTCC[C/T]
GGTTTTTATTGGAACCGGAACTATTGTAGTTTTCGGCCAACCCTGCAAAGATCAGTTTTCTAGTAGTTTGACAGATGCATCTCCTATATATATGTCATCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 10.30% | 0.87% | 2.18% | NA |
| All Indica | 2759 | 95.50% | 2.60% | 0.25% | 1.56% | NA |
| All Japonica | 1512 | 81.00% | 17.40% | 1.59% | 0.07% | NA |
| Aus | 269 | 45.40% | 53.90% | 0.37% | 0.37% | NA |
| Indica I | 595 | 95.50% | 4.20% | 0.00% | 0.34% | NA |
| Indica II | 465 | 98.10% | 0.20% | 0.43% | 1.29% | NA |
| Indica III | 913 | 97.20% | 1.10% | 0.22% | 1.53% | NA |
| Indica Intermediate | 786 | 92.20% | 4.70% | 0.38% | 2.67% | NA |
| Temperate Japonica | 767 | 88.30% | 11.20% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 78.60% | 17.70% | 3.77% | 0.00% | NA |
| Japonica Intermediate | 241 | 62.70% | 36.50% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 38.50% | 1.00% | 6.25% | 54.17% | NA |
| Intermediate | 90 | 83.30% | 6.70% | 3.33% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0909288154 | G -> DEL | N | N | silent_mutation | Average:44.099; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0909288154 | G -> A | LOC_Os09g15260.1 | downstream_gene_variant ; 4118.0bp to feature; MODIFIER | silent_mutation | Average:44.099; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| vg0909288154 | G -> A | LOC_Os09g15260-LOC_Os09g15270 | intergenic_region ; MODIFIER | silent_mutation | Average:44.099; most accessible tissue: Zhenshan97 panicle, score: 61.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0909288154 | NA | 2.44E-11 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 2.15E-08 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 7.75E-16 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 1.14E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 5.16E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | 4.43E-07 | NA | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 4.00E-15 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 4.61E-07 | mr1597_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 7.41E-08 | mr1702_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 3.87E-07 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 1.46E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 8.47E-09 | mr1707_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 6.86E-09 | mr1729_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 5.12E-10 | mr1740_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 2.26E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0909288154 | NA | 6.21E-09 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |