Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0909136644:

Variant ID: vg0909136644 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 9136644
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTGAGTGATGCGGGTTCCGATTGCTTCTTCTAGGATGAGAACTTAATGGGGTAAACCCCTAGTCGGTGTGCTTGTGTTTGGGTAGTCAAGCTTCCGGC[G/A,C]
TTCTCTAATAAGTTTATTTGGCCGGTCGGCCTATGTATCTATTAAGCTGTTGTAAGTCTTAAGTTTCTTTCATCTTAGTTGTGTTTACTATGTATAATCA

Reverse complement sequence

TGATTATACATAGTAAACACAACTAAGATGAAAGAAACTTAAGACTTACAACAGCTTAATAGATACATAGGCCGACCGGCCAAATAAACTTATTAGAGAA[C/T,G]
GCCGGAAGCTTGACTACCCAAACACAAGCACACCGACTAGGGGTTTACCCCATTAAGTTCTCATCCTAGAAGAAGCAATCGGAACCCGCATCACTCAAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	8.60%	0.89%	1.88%	NA
All Indica	2759	94.00%	1.60%	1.41%	2.94%	NA
All Japonica	1512	92.40%	7.60%	0.00%	0.00%	NA
Aus	269	32.70%	63.20%	1.12%	2.97%	NA
Indica I	595	96.10%	0.30%	1.18%	2.35%	NA
Indica II	465	97.20%	0.00%	0.65%	2.15%	NA
Indica III	913	93.40%	0.80%	1.97%	3.83%	NA
Indica Intermediate	786	91.20%	4.60%	1.40%	2.80%	NA
Temperate Japonica	767	87.90%	12.10%	0.00%	0.00%	NA
Tropical Japonica	504	96.60%	3.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	36.50%	63.50%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0909136644	G -> DEL	N	N	silent_mutation	Average:45.126; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0909136644	G -> C	LOC_Os09g15070-LOC_Os09g15090	intergenic_region ; MODIFIER	N	Average:45.126; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N
vg0909136644	G -> A	LOC_Os09g15070-LOC_Os09g15090	intergenic_region ; MODIFIER	silent_mutation	Average:45.126; most accessible tissue: Minghui63 flag leaf, score: 73.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0909136644	NA	1.48E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909136644	NA	1.06E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909136644	NA	1.01E-12	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909136644	NA	1.68E-11	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909136644	NA	3.38E-06	mr1625	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909136644	NA	9.25E-07	mr1684	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909136644	NA	3.18E-08	mr1734	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909136644	NA	2.54E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0909136644	NA	5.62E-06	mr1892_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251