Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0908734371:

Variant ID: vg0908734371 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8734371
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTAAACGTTTTCATATATGGGTTTAAAATTTTCAAAATTTGGCTTCAGATATAGATTTTATTTTCAATTTGTTAGTTAAAAAAATCTCACGGAAAAAA[T/G]
AAAATCTTATCTACTACCGTCATTATCTCATACTGTCGTTATCTAAGACTAATACTAGTCTAACCACCTTATCCCAGCAAAAACGCGCGTTGGCAGCGCA

Reverse complement sequence

TGCGCTGCCAACGCGCGTTTTTGCTGGGATAAGGTGGTTAGACTAGTATTAGTCTTAGATAACGACAGTATGAGATAATGACGGTAGTAGATAAGATTTT[A/C]
TTTTTTCCGTGAGATTTTTTTAACTAACAAATTGAAAATAAAATCTATATCTGAAGCCAAATTTTGAAAATTTTAAACCCATATATGAAAACGTTTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.20%	32.80%	12.36%	5.69%	NA
All Indica	2759	21.00%	54.80%	15.22%	9.03%	NA
All Japonica	1512	94.40%	0.90%	3.77%	0.93%	NA
Aus	269	73.20%	5.60%	20.82%	0.37%	NA
Indica I	595	7.90%	73.10%	16.47%	2.52%	NA
Indica II	465	42.60%	27.70%	11.61%	18.06%	NA
Indica III	913	16.00%	60.40%	15.33%	8.32%	NA
Indica Intermediate	786	23.90%	50.40%	16.28%	9.41%	NA
Temperate Japonica	767	95.00%	1.20%	2.09%	1.69%	NA
Tropical Japonica	504	92.90%	0.80%	6.35%	0.00%	NA
Japonica Intermediate	241	95.40%	0.40%	3.73%	0.41%	NA
VI/Aromatic	96	59.40%	1.00%	38.54%	1.04%	NA
Intermediate	90	70.00%	10.00%	15.56%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908734371	T -> G	LOC_Os09g14700.2	upstream_gene_variant ; 4691.0bp to feature; MODIFIER	silent_mutation	Average:54.232; most accessible tissue: Minghui63 root, score: 76.425	N	N	N	N
vg0908734371	T -> G	LOC_Os09g14710.1	upstream_gene_variant ; 2447.0bp to feature; MODIFIER	silent_mutation	Average:54.232; most accessible tissue: Minghui63 root, score: 76.425	N	N	N	N
vg0908734371	T -> G	LOC_Os09g14700.1	upstream_gene_variant ; 4691.0bp to feature; MODIFIER	silent_mutation	Average:54.232; most accessible tissue: Minghui63 root, score: 76.425	N	N	N	N
vg0908734371	T -> G	LOC_Os09g14700-LOC_Os09g14710	intergenic_region ; MODIFIER	silent_mutation	Average:54.232; most accessible tissue: Minghui63 root, score: 76.425	N	N	N	N
vg0908734371	T -> DEL	N	N	silent_mutation	Average:54.232; most accessible tissue: Minghui63 root, score: 76.425	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908734371	NA	1.27E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	6.72E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	5.03E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	4.59E-06	2.67E-20	mr1362_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	3.71E-06	mr1362_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	1.91E-06	mr1510_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	5.17E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	2.79E-16	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	2.82E-07	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	9.58E-11	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	7.90E-06	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	9.58E-11	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908734371	NA	7.90E-06	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251