\
| Variant ID: vg0908734371 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8734371 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 100. )
ATTTAAACGTTTTCATATATGGGTTTAAAATTTTCAAAATTTGGCTTCAGATATAGATTTTATTTTCAATTTGTTAGTTAAAAAAATCTCACGGAAAAAA[T/G]
AAAATCTTATCTACTACCGTCATTATCTCATACTGTCGTTATCTAAGACTAATACTAGTCTAACCACCTTATCCCAGCAAAAACGCGCGTTGGCAGCGCA
TGCGCTGCCAACGCGCGTTTTTGCTGGGATAAGGTGGTTAGACTAGTATTAGTCTTAGATAACGACAGTATGAGATAATGACGGTAGTAGATAAGATTTT[A/C]
TTTTTTCCGTGAGATTTTTTTAACTAACAAATTGAAAATAAAATCTATATCTGAAGCCAAATTTTGAAAATTTTAAACCCATATATGAAAACGTTTAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.20% | 32.80% | 12.36% | 5.69% | NA |
| All Indica | 2759 | 21.00% | 54.80% | 15.22% | 9.03% | NA |
| All Japonica | 1512 | 94.40% | 0.90% | 3.77% | 0.93% | NA |
| Aus | 269 | 73.20% | 5.60% | 20.82% | 0.37% | NA |
| Indica I | 595 | 7.90% | 73.10% | 16.47% | 2.52% | NA |
| Indica II | 465 | 42.60% | 27.70% | 11.61% | 18.06% | NA |
| Indica III | 913 | 16.00% | 60.40% | 15.33% | 8.32% | NA |
| Indica Intermediate | 786 | 23.90% | 50.40% | 16.28% | 9.41% | NA |
| Temperate Japonica | 767 | 95.00% | 1.20% | 2.09% | 1.69% | NA |
| Tropical Japonica | 504 | 92.90% | 0.80% | 6.35% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.40% | 3.73% | 0.41% | NA |
| VI/Aromatic | 96 | 59.40% | 1.00% | 38.54% | 1.04% | NA |
| Intermediate | 90 | 70.00% | 10.00% | 15.56% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908734371 | T -> G | LOC_Os09g14700.2 | upstream_gene_variant ; 4691.0bp to feature; MODIFIER | silent_mutation | Average:54.232; most accessible tissue: Minghui63 root, score: 76.425 | N | N | N | N |
| vg0908734371 | T -> G | LOC_Os09g14710.1 | upstream_gene_variant ; 2447.0bp to feature; MODIFIER | silent_mutation | Average:54.232; most accessible tissue: Minghui63 root, score: 76.425 | N | N | N | N |
| vg0908734371 | T -> G | LOC_Os09g14700.1 | upstream_gene_variant ; 4691.0bp to feature; MODIFIER | silent_mutation | Average:54.232; most accessible tissue: Minghui63 root, score: 76.425 | N | N | N | N |
| vg0908734371 | T -> G | LOC_Os09g14700-LOC_Os09g14710 | intergenic_region ; MODIFIER | silent_mutation | Average:54.232; most accessible tissue: Minghui63 root, score: 76.425 | N | N | N | N |
| vg0908734371 | T -> DEL | N | N | silent_mutation | Average:54.232; most accessible tissue: Minghui63 root, score: 76.425 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908734371 | NA | 1.27E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 6.72E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 5.03E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | 4.59E-06 | 2.67E-20 | mr1362_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 3.71E-06 | mr1362_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 1.91E-06 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 5.17E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 2.79E-16 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 2.82E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 9.58E-11 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 7.90E-06 | mr1946_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 9.58E-11 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908734371 | NA | 7.90E-06 | mr1948_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |