\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908699572:

Variant ID: vg0908699572 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8699572
Reference Allele: TAlternative Allele: C,G,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATATCTAGACAATCAAGCCGTTGGATGTTTCATAGAGTGGTGGATATCCTATATAATCTAAGTCAATATCGGTGCTTAACCTAATCGGCTGCCTTCTAG[T/C,G,A]
AATAGACGTTAGCCGATTGAAGGTTAGATAGCAATATTGCTAGAGATTATATAAGATATATGATAACTCGACGAATTACATAAACAAGATTAGAGTATCA

Reverse complement sequence

TGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATCTTATATAATCTCTAGCAATATTGCTATCTAACCTTCAATCGGCTAACGTCTATT[A/G,C,T]
CTAGAAGGCAGCCGATTAGGTTAAGCACCGATATTGACTTAGATTATATAGGATATCCACCACTCTATGAAACATCCAACGGCTTGATTGTCTAGATATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.80% 11.30% 17.18% 28.18% A: 0.40%; G: 0.15%
All Indica  2759 36.00% 17.50% 20.95% 25.08% A: 0.47%
All Japonica  1512 50.30% 0.50% 8.20% 40.21% G: 0.46%; A: 0.40%
Aus  269 45.70% 14.90% 35.32% 4.09% NA
Indica I  595 19.00% 11.30% 19.50% 49.58% A: 0.67%
Indica II  465 66.70% 4.30% 13.33% 15.70% NA
Indica III  913 32.10% 28.70% 25.19% 13.25% A: 0.77%
Indica Intermediate  786 35.20% 17.00% 21.63% 25.83% A: 0.25%
Temperate Japonica  767 84.70% 0.70% 1.17% 13.43% NA
Tropical Japonica  504 5.60% 0.40% 20.63% 70.83% G: 1.39%; A: 1.19%
Japonica Intermediate  241 34.00% 0.00% 4.56% 61.41% NA
VI/Aromatic  96 90.60% 0.00% 4.17% 5.21% NA
Intermediate  90 64.40% 5.60% 12.22% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908699572 T -> G LOC_Os09g14670.1 upstream_gene_variant ; 1999.0bp to feature; MODIFIER silent_mutation Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0908699572 T -> G LOC_Os09g14670-LOC_Os09g14680 intergenic_region ; MODIFIER silent_mutation Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0908699572 T -> DEL N N silent_mutation Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0908699572 T -> C LOC_Os09g14670.1 upstream_gene_variant ; 1999.0bp to feature; MODIFIER silent_mutation Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0908699572 T -> C LOC_Os09g14670-LOC_Os09g14680 intergenic_region ; MODIFIER silent_mutation Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0908699572 T -> A LOC_Os09g14670.1 upstream_gene_variant ; 1999.0bp to feature; MODIFIER silent_mutation Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N
vg0908699572 T -> A LOC_Os09g14670-LOC_Os09g14680 intergenic_region ; MODIFIER silent_mutation Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908699572 NA 9.61E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 2.28E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 2.49E-07 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 8.27E-10 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 1.27E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 4.99E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 1.80E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 9.71E-08 mr1362_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 5.01E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 2.74E-06 mr1415_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 3.70E-06 mr1415_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 3.71E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 5.74E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 6.85E-06 mr1500_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 2.58E-06 mr1505_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 8.75E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 3.61E-06 mr1562_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 7.54E-10 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 6.86E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 8.16E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 4.92E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 3.68E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 5.23E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 6.61E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 4.26E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572 NA 3.51E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251