Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908699572:

Variant ID: vg0908699572 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8699572
Reference Allele: T	Alternative Allele: C,G,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATCTAGACAATCAAGCCGTTGGATGTTTCATAGAGTGGTGGATATCCTATATAATCTAAGTCAATATCGGTGCTTAACCTAATCGGCTGCCTTCTAG[T/C,G,A]
AATAGACGTTAGCCGATTGAAGGTTAGATAGCAATATTGCTAGAGATTATATAAGATATATGATAACTCGACGAATTACATAAACAAGATTAGAGTATCA

Reverse complement sequence

TGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCATATATCTTATATAATCTCTAGCAATATTGCTATCTAACCTTCAATCGGCTAACGTCTATT[A/G,C,T]
CTAGAAGGCAGCCGATTAGGTTAAGCACCGATATTGACTTAGATTATATAGGATATCCACCACTCTATGAAACATCCAACGGCTTGATTGTCTAGATATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.80%	11.30%	17.18%	28.18%	A: 0.40%; G: 0.15%
All Indica	2759	36.00%	17.50%	20.95%	25.08%	A: 0.47%
All Japonica	1512	50.30%	0.50%	8.20%	40.21%	G: 0.46%; A: 0.40%
Aus	269	45.70%	14.90%	35.32%	4.09%	NA
Indica I	595	19.00%	11.30%	19.50%	49.58%	A: 0.67%
Indica II	465	66.70%	4.30%	13.33%	15.70%	NA
Indica III	913	32.10%	28.70%	25.19%	13.25%	A: 0.77%
Indica Intermediate	786	35.20%	17.00%	21.63%	25.83%	A: 0.25%
Temperate Japonica	767	84.70%	0.70%	1.17%	13.43%	NA
Tropical Japonica	504	5.60%	0.40%	20.63%	70.83%	G: 1.39%; A: 1.19%
Japonica Intermediate	241	34.00%	0.00%	4.56%	61.41%	NA
VI/Aromatic	96	90.60%	0.00%	4.17%	5.21%	NA
Intermediate	90	64.40%	5.60%	12.22%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908699572	T -> G	LOC_Os09g14670.1	upstream_gene_variant ; 1999.0bp to feature; MODIFIER	silent_mutation	Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0908699572	T -> G	LOC_Os09g14670-LOC_Os09g14680	intergenic_region ; MODIFIER	silent_mutation	Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0908699572	T -> DEL	N	N	silent_mutation	Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0908699572	T -> C	LOC_Os09g14670.1	upstream_gene_variant ; 1999.0bp to feature; MODIFIER	silent_mutation	Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0908699572	T -> C	LOC_Os09g14670-LOC_Os09g14680	intergenic_region ; MODIFIER	silent_mutation	Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0908699572	T -> A	LOC_Os09g14670.1	upstream_gene_variant ; 1999.0bp to feature; MODIFIER	silent_mutation	Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0908699572	T -> A	LOC_Os09g14670-LOC_Os09g14680	intergenic_region ; MODIFIER	silent_mutation	Average:24.594; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908699572	NA	9.61E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	2.28E-06	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	2.49E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	8.27E-10	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	1.27E-07	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	4.99E-08	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	1.80E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	9.71E-08	mr1362_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	5.01E-06	mr1402_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	2.74E-06	mr1415_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	3.70E-06	mr1415_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	3.71E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	5.74E-07	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	6.85E-06	mr1500_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	2.58E-06	mr1505_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	8.75E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	3.61E-06	mr1562_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	7.54E-10	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	6.86E-07	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	8.16E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	4.92E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	3.68E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	5.23E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	6.61E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	4.26E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908699572	NA	3.51E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251