\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908600483:

Variant ID: vg0908600483 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8600483
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAGAAACTATAACAACATATATAGATTTGTCTGTCAAAACACTATAATAAAAGTAAGCATGCATTTAATTATTGCATATATTATAATAGAAAAATAAG[G/A]
TCAAAGATATATTTTGTAGACCGTGTCATTGTCTAAAATGTCAATTAAAATGAAACCGGAAGAAGTATGTTTACTCTGCATTTAGTGTCCTAAATATTGA

Reverse complement sequence

TCAATATTTAGGACACTAAATGCAGAGTAAACATACTTCTTCCGGTTTCATTTTAATTGACATTTTAGACAATGACACGGTCTACAAAATATATCTTTGA[C/T]
CTTATTTTTCTATTATAATATATGCAATAATTAAATGCATGCTTACTTTTATTATAGTGTTTTGACAGACAAATCTATATATGTTGTTATAGTTTCTTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 36.80% 0.19% 0.00% NA
All Indica  2759 40.20% 59.50% 0.33% 0.00% NA
All Japonica  1512 97.00% 3.00% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 10.90% 88.70% 0.34% 0.00% NA
Indica II  465 75.70% 24.10% 0.22% 0.00% NA
Indica III  913 39.00% 60.90% 0.11% 0.00% NA
Indica Intermediate  786 42.70% 56.60% 0.64% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 93.50% 6.50% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908600483 G -> A LOC_Os09g14530.1 upstream_gene_variant ; 3173.0bp to feature; MODIFIER silent_mutation Average:33.209; most accessible tissue: Callus, score: 59.305 N N N N
vg0908600483 G -> A LOC_Os09g14540.1 downstream_gene_variant ; 2979.0bp to feature; MODIFIER silent_mutation Average:33.209; most accessible tissue: Callus, score: 59.305 N N N N
vg0908600483 G -> A LOC_Os09g14530-LOC_Os09g14540 intergenic_region ; MODIFIER silent_mutation Average:33.209; most accessible tissue: Callus, score: 59.305 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908600483 NA 2.18E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 1.76E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 1.02E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 5.49E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 9.78E-10 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 4.53E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 4.00E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 1.18E-10 mr1610 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 1.35E-12 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 1.17E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 1.35E-20 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 3.15E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 6.27E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 2.65E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 2.34E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 2.84E-36 mr1598_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 3.56E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 6.81E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 1.57E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483 NA 1.57E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251