Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908600483:

Variant ID: vg0908600483 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8600483
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TAAAGAAACTATAACAACATATATAGATTTGTCTGTCAAAACACTATAATAAAAGTAAGCATGCATTTAATTATTGCATATATTATAATAGAAAAATAAG[G/A]
TCAAAGATATATTTTGTAGACCGTGTCATTGTCTAAAATGTCAATTAAAATGAAACCGGAAGAAGTATGTTTACTCTGCATTTAGTGTCCTAAATATTGA

Reverse complement sequence

TCAATATTTAGGACACTAAATGCAGAGTAAACATACTTCTTCCGGTTTCATTTTAATTGACATTTTAGACAATGACACGGTCTACAAAATATATCTTTGA[C/T]
CTTATTTTTCTATTATAATATATGCAATAATTAAATGCATGCTTACTTTTATTATAGTGTTTTGACAGACAAATCTATATATGTTGTTATAGTTTCTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.00%	36.80%	0.19%	0.00%	NA
All Indica	2759	40.20%	59.50%	0.33%	0.00%	NA
All Japonica	1512	97.00%	3.00%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	10.90%	88.70%	0.34%	0.00%	NA
Indica II	465	75.70%	24.10%	0.22%	0.00%	NA
Indica III	913	39.00%	60.90%	0.11%	0.00%	NA
Indica Intermediate	786	42.70%	56.60%	0.64%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	93.50%	6.50%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	68.80%	31.20%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908600483	G -> A	LOC_Os09g14530.1	upstream_gene_variant ; 3173.0bp to feature; MODIFIER	silent_mutation	Average:33.209; most accessible tissue: Callus, score: 59.305	N	N	N	N
vg0908600483	G -> A	LOC_Os09g14540.1	downstream_gene_variant ; 2979.0bp to feature; MODIFIER	silent_mutation	Average:33.209; most accessible tissue: Callus, score: 59.305	N	N	N	N
vg0908600483	G -> A	LOC_Os09g14530-LOC_Os09g14540	intergenic_region ; MODIFIER	silent_mutation	Average:33.209; most accessible tissue: Callus, score: 59.305	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908600483	NA	2.18E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	1.76E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	1.02E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	5.49E-09	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	9.78E-10	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	4.53E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	4.00E-19	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	1.18E-10	mr1610	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	1.35E-12	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	1.17E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	1.35E-20	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	3.15E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	6.27E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	2.65E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	2.34E-06	mr1592_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	2.84E-36	mr1598_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	3.56E-10	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	6.81E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	1.57E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908600483	NA	1.57E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251