Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908594707:

Variant ID: vg0908594707 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 8594707
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAAATTGGCTACATGTATAGTTCAAAGTAGACACGTCAAATTAATGATAAGTAGAGAATTTTGTCCATACCAAACCAATATCCAATAGATGATGTTTCA[A/C]
TGCCAGTCACTTATTATTCTTCATTAGTAATCTGTACAAAGAAAAAAAAAGGGCAAATGAACGATTAATCGAAAATGACTTATTTTGAATTCAAATAATT

Reverse complement sequence

AATTATTTGAATTCAAAATAAGTCATTTTCGATTAATCGTTCATTTGCCCTTTTTTTTTCTTTGTACAGATTACTAATGAAGAATAATAAGTGACTGGCA[T/G]
TGAAACATCATCTATTGGATATTGGTTTGGTATGGACAAAATTCTCTACTTATCATTAATTTGACGTGTCTACTTTGAACTATACATGTAGCCAATTTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.30%	0.60%	26.34%	39.76%	NA
All Indica	2759	24.70%	0.90%	26.82%	47.63%	NA
All Japonica	1512	51.20%	0.10%	17.66%	31.08%	NA
Aus	269	8.60%	0.00%	63.57%	27.88%	NA
Indica I	595	10.80%	0.20%	24.03%	65.04%	NA
Indica II	465	58.30%	0.00%	23.87%	17.85%	NA
Indica III	913	13.30%	2.40%	31.11%	53.23%	NA
Indica Intermediate	786	28.60%	0.10%	25.70%	45.55%	NA
Temperate Japonica	767	88.50%	0.00%	4.04%	7.43%	NA
Tropical Japonica	504	3.80%	0.00%	38.49%	57.74%	NA
Japonica Intermediate	241	31.50%	0.40%	17.43%	50.62%	NA
VI/Aromatic	96	50.00%	1.00%	47.92%	1.04%	NA
Intermediate	90	55.60%	0.00%	23.33%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0908594707	A -> DEL	N	N	silent_mutation	Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0908594707	A -> C	LOC_Os09g14520.1	upstream_gene_variant ; 1735.0bp to feature; MODIFIER	silent_mutation	Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0908594707	A -> C	LOC_Os09g14510.1	downstream_gene_variant ; 4758.0bp to feature; MODIFIER	silent_mutation	Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0908594707	A -> C	LOC_Os09g14530.1	downstream_gene_variant ; 14.0bp to feature; MODIFIER	silent_mutation	Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0908594707	A -> C	LOC_Os09g14510.3	downstream_gene_variant ; 4758.0bp to feature; MODIFIER	silent_mutation	Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0908594707	A -> C	LOC_Os09g14510.2	downstream_gene_variant ; 4758.0bp to feature; MODIFIER	silent_mutation	Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0908594707	A -> C	LOC_Os09g14520-LOC_Os09g14530	intergenic_region ; MODIFIER	silent_mutation	Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0908594707	NA	3.05E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	4.50E-06	mr1042	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	3.36E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	6.35E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	9.02E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	1.17E-06	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	1.51E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	3.96E-10	mr1271	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	1.19E-09	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	2.69E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	2.43E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	1.17E-07	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	5.77E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	6.32E-06	mr1565	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	1.01E-06	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	6.19E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	3.59E-10	mr1087_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	3.38E-08	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	3.21E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	4.12E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	3.68E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	3.09E-08	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	8.33E-11	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	2.78E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	1.81E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707	NA	3.38E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251