\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908594707:

Variant ID: vg0908594707 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8594707
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAAATTGGCTACATGTATAGTTCAAAGTAGACACGTCAAATTAATGATAAGTAGAGAATTTTGTCCATACCAAACCAATATCCAATAGATGATGTTTCA[A/C]
TGCCAGTCACTTATTATTCTTCATTAGTAATCTGTACAAAGAAAAAAAAAGGGCAAATGAACGATTAATCGAAAATGACTTATTTTGAATTCAAATAATT

Reverse complement sequence

AATTATTTGAATTCAAAATAAGTCATTTTCGATTAATCGTTCATTTGCCCTTTTTTTTTCTTTGTACAGATTACTAATGAAGAATAATAAGTGACTGGCA[T/G]
TGAAACATCATCTATTGGATATTGGTTTGGTATGGACAAAATTCTCTACTTATCATTAATTTGACGTGTCTACTTTGAACTATACATGTAGCCAATTTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.30% 0.60% 26.34% 39.76% NA
All Indica  2759 24.70% 0.90% 26.82% 47.63% NA
All Japonica  1512 51.20% 0.10% 17.66% 31.08% NA
Aus  269 8.60% 0.00% 63.57% 27.88% NA
Indica I  595 10.80% 0.20% 24.03% 65.04% NA
Indica II  465 58.30% 0.00% 23.87% 17.85% NA
Indica III  913 13.30% 2.40% 31.11% 53.23% NA
Indica Intermediate  786 28.60% 0.10% 25.70% 45.55% NA
Temperate Japonica  767 88.50% 0.00% 4.04% 7.43% NA
Tropical Japonica  504 3.80% 0.00% 38.49% 57.74% NA
Japonica Intermediate  241 31.50% 0.40% 17.43% 50.62% NA
VI/Aromatic  96 50.00% 1.00% 47.92% 1.04% NA
Intermediate  90 55.60% 0.00% 23.33% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908594707 A -> DEL N N silent_mutation Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0908594707 A -> C LOC_Os09g14520.1 upstream_gene_variant ; 1735.0bp to feature; MODIFIER silent_mutation Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0908594707 A -> C LOC_Os09g14510.1 downstream_gene_variant ; 4758.0bp to feature; MODIFIER silent_mutation Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0908594707 A -> C LOC_Os09g14530.1 downstream_gene_variant ; 14.0bp to feature; MODIFIER silent_mutation Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0908594707 A -> C LOC_Os09g14510.3 downstream_gene_variant ; 4758.0bp to feature; MODIFIER silent_mutation Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0908594707 A -> C LOC_Os09g14510.2 downstream_gene_variant ; 4758.0bp to feature; MODIFIER silent_mutation Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0908594707 A -> C LOC_Os09g14520-LOC_Os09g14530 intergenic_region ; MODIFIER silent_mutation Average:29.334; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908594707 NA 3.05E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 4.50E-06 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 3.36E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 6.35E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 9.02E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 1.17E-06 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 1.51E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 3.96E-10 mr1271 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 1.19E-09 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 2.69E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 2.43E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 1.17E-07 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 5.77E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 6.32E-06 mr1565 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 1.01E-06 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 6.19E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 3.59E-10 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 3.38E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 3.21E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 4.12E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 3.68E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 3.09E-08 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 8.33E-11 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 2.78E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 1.81E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908594707 NA 3.38E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251