\
| Variant ID: vg0908550860 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8550860 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTCAGGCTATGTCTCTGGATCAATCAAACGGTCCCTTCTGCACTTGGCAAGCTGATGAAGGTAGTTGGACTTGGGTCTTCCAATGTGGTGCATAGGAGTG[G/C]
TGTCAAATCCAAGAGACTTGTAGAGTCGAACGGGATTCTCACGAGATCCTATCGGGAAATCATGAGAGGCCCTTCCAGCCCCACAACTGTGACCACCACC
GGTGGTGGTCACAGTTGTGGGGCTGGAAGGGCCTCTCATGATTTCCCGATAGGATCTCGTGAGAATCCCGTTCGACTCTACAAGTCTCTTGGATTTGACA[C/G]
CACTCCTATGCACCACATTGGAAGACCCAAGTCCAACTACCTTCATCAGCTTGCCAAGTGCAGAAGGGACCGTTTGATTGATCCAGAGACATAGCCTGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.90% | 6.40% | 4.61% | 23.11% | NA |
| All Indica | 2759 | 49.40% | 4.00% | 7.61% | 39.00% | NA |
| All Japonica | 1512 | 99.30% | 0.30% | 0.20% | 0.13% | NA |
| Aus | 269 | 27.90% | 67.30% | 1.86% | 2.97% | NA |
| Indica I | 595 | 26.90% | 0.20% | 11.76% | 61.18% | NA |
| Indica II | 465 | 75.50% | 1.50% | 3.01% | 20.00% | NA |
| Indica III | 913 | 51.30% | 5.70% | 8.43% | 34.61% | NA |
| Indica Intermediate | 786 | 49.00% | 6.20% | 6.23% | 38.55% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 5.60% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908550860 | G -> DEL | N | N | silent_mutation | Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0908550860 | G -> C | LOC_Os09g14460.1 | upstream_gene_variant ; 161.0bp to feature; MODIFIER | silent_mutation | Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0908550860 | G -> C | LOC_Os09g14470.1 | downstream_gene_variant ; 1418.0bp to feature; MODIFIER | silent_mutation | Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| vg0908550860 | G -> C | LOC_Os09g14460-LOC_Os09g14470 | intergenic_region ; MODIFIER | silent_mutation | Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908550860 | NA | 1.08E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | NA | 8.65E-07 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | NA | 6.83E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | NA | 3.63E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | NA | 3.55E-07 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | NA | 2.65E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | NA | 3.70E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | NA | 5.98E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | NA | 4.80E-06 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | 2.03E-06 | 4.54E-08 | mr1928 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908550860 | NA | 4.25E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |