\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908550860:

Variant ID: vg0908550860 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8550860
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAGGCTATGTCTCTGGATCAATCAAACGGTCCCTTCTGCACTTGGCAAGCTGATGAAGGTAGTTGGACTTGGGTCTTCCAATGTGGTGCATAGGAGTG[G/C]
TGTCAAATCCAAGAGACTTGTAGAGTCGAACGGGATTCTCACGAGATCCTATCGGGAAATCATGAGAGGCCCTTCCAGCCCCACAACTGTGACCACCACC

Reverse complement sequence

GGTGGTGGTCACAGTTGTGGGGCTGGAAGGGCCTCTCATGATTTCCCGATAGGATCTCGTGAGAATCCCGTTCGACTCTACAAGTCTCTTGGATTTGACA[C/G]
CACTCCTATGCACCACATTGGAAGACCCAAGTCCAACTACCTTCATCAGCTTGCCAAGTGCAGAAGGGACCGTTTGATTGATCCAGAGACATAGCCTGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 6.40% 4.61% 23.11% NA
All Indica  2759 49.40% 4.00% 7.61% 39.00% NA
All Japonica  1512 99.30% 0.30% 0.20% 0.13% NA
Aus  269 27.90% 67.30% 1.86% 2.97% NA
Indica I  595 26.90% 0.20% 11.76% 61.18% NA
Indica II  465 75.50% 1.50% 3.01% 20.00% NA
Indica III  913 51.30% 5.70% 8.43% 34.61% NA
Indica Intermediate  786 49.00% 6.20% 6.23% 38.55% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.40% 0.40% 0.00% 0.20% NA
Japonica Intermediate  241 97.90% 0.80% 1.24% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 87.80% 5.60% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908550860 G -> DEL N N silent_mutation Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0908550860 G -> C LOC_Os09g14460.1 upstream_gene_variant ; 161.0bp to feature; MODIFIER silent_mutation Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0908550860 G -> C LOC_Os09g14470.1 downstream_gene_variant ; 1418.0bp to feature; MODIFIER silent_mutation Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0908550860 G -> C LOC_Os09g14460-LOC_Os09g14470 intergenic_region ; MODIFIER silent_mutation Average:26.726; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908550860 NA 1.08E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 NA 8.65E-07 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 NA 6.83E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 NA 3.63E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 NA 3.55E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 NA 2.65E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 NA 3.70E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 NA 5.98E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 NA 4.80E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 2.03E-06 4.54E-08 mr1928 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908550860 NA 4.25E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251