\
| Variant ID: vg0908143257 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 8143257 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 232. )
ATCTGTAGCTCCGATTGACTCCGTTCCACCTCCAGTGATTCCGTAAAATTGAGATCTATCTAATGGCACTATTAATTAGTCTAACTAGATGACACCCCGC[G/A]
CGTTGCAGCGGGAATTTTTAAGTGGCATTCTAAACAAAATTTCGTAAACAGACATGTGTATGATTTGAAAAGTGTCATAGTTTGATTGATACTTGAGAAA
TTTCTCAAGTATCAATCAAACTATGACACTTTTCAAATCATACACATGTCTGTTTACGAAATTTTGTTTAGAATGCCACTTAAAAATTCCCGCTGCAACG[C/T]
GCGGGGTGTCATCTAGTTAGACTAATTAATAGTGCCATTAGATAGATCTCAATTTTACGGAATCACTGGAGGTGGAACGGAGTCAATCGGAGCTACAGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.50% | 4.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.80% | 1.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0908143257 | G -> A | LOC_Os09g13860.1 | upstream_gene_variant ; 1449.0bp to feature; MODIFIER | silent_mutation | Average:42.743; most accessible tissue: Callus, score: 62.641 | N | N | N | N |
| vg0908143257 | G -> A | LOC_Os09g13850.1 | downstream_gene_variant ; 4700.0bp to feature; MODIFIER | silent_mutation | Average:42.743; most accessible tissue: Callus, score: 62.641 | N | N | N | N |
| vg0908143257 | G -> A | LOC_Os09g13860-LOC_Os09g13870 | intergenic_region ; MODIFIER | silent_mutation | Average:42.743; most accessible tissue: Callus, score: 62.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0908143257 | NA | 4.58E-08 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | NA | 4.19E-08 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | 8.29E-08 | 3.80E-10 | mr1104 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | NA | 2.03E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | NA | 1.35E-09 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | NA | 1.08E-06 | mr1227 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | NA | 3.57E-09 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | 9.69E-07 | 9.69E-07 | mr1499 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | NA | 3.20E-07 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | NA | 3.56E-07 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0908143257 | NA | 1.65E-08 | mr1404_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |