\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0908143257:

Variant ID: vg0908143257 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 8143257
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTGTAGCTCCGATTGACTCCGTTCCACCTCCAGTGATTCCGTAAAATTGAGATCTATCTAATGGCACTATTAATTAGTCTAACTAGATGACACCCCGC[G/A]
CGTTGCAGCGGGAATTTTTAAGTGGCATTCTAAACAAAATTTCGTAAACAGACATGTGTATGATTTGAAAAGTGTCATAGTTTGATTGATACTTGAGAAA

Reverse complement sequence

TTTCTCAAGTATCAATCAAACTATGACACTTTTCAAATCATACACATGTCTGTTTACGAAATTTTGTTTAGAATGCCACTTAAAAATTCCCGCTGCAACG[C/T]
GCGGGGTGTCATCTAGTTAGACTAATTAATAGTGCCATTAGATAGATCTCAATTTTACGGAATCACTGGAGGTGGAACGGAGTCAATCGGAGCTACAGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.50% 4.50% 0.02% 0.00% NA
All Indica  2759 93.10% 6.90% 0.00% 0.00% NA
All Japonica  1512 98.80% 1.10% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.80% 3.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 86.30% 13.70% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 5.00% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.80% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0908143257 G -> A LOC_Os09g13860.1 upstream_gene_variant ; 1449.0bp to feature; MODIFIER silent_mutation Average:42.743; most accessible tissue: Callus, score: 62.641 N N N N
vg0908143257 G -> A LOC_Os09g13850.1 downstream_gene_variant ; 4700.0bp to feature; MODIFIER silent_mutation Average:42.743; most accessible tissue: Callus, score: 62.641 N N N N
vg0908143257 G -> A LOC_Os09g13860-LOC_Os09g13870 intergenic_region ; MODIFIER silent_mutation Average:42.743; most accessible tissue: Callus, score: 62.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0908143257 NA 4.58E-08 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 NA 4.19E-08 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 8.29E-08 3.80E-10 mr1104 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 NA 2.03E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 NA 1.35E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 NA 1.08E-06 mr1227 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 NA 3.57E-09 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 9.69E-07 9.69E-07 mr1499 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 NA 3.20E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 NA 3.56E-07 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0908143257 NA 1.65E-08 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251