\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907939520:

Variant ID: vg0907939520 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7939520
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGCAAGCCTACATCGTCGAGCATCCTCCATCGCTACCTTGAGCCCATGGCTTCCTCAATTTTTCCGCTCTCCTTTCCTCCTGGCTCTTGCTCAAATGT[T/C]
AGTTGCTCGACTGGCGATTGTTCACCTGTCATCGGTTGCCATCGTGCCACATGGCCCAAGCTGTGTGCTATTCCTAAATCATGTCGTGCTGGCTCGCTAC

Reverse complement sequence

GTAGCGAGCCAGCACGACATGATTTAGGAATAGCACACAGCTTGGGCCATGTGGCACGATGGCAACCGATGACAGGTGAACAATCGCCAGTCGAGCAACT[A/G]
ACATTTGAGCAAGAGCCAGGAGGAAAGGAGAGCGGAAAAATTGAGGAAGCCATGGGCTCAAGGTAGCGATGGAGGATGCTCGACGATGTAGGCTTGCACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 31.90% 0.02% 0.00% NA
All Indica  2759 91.50% 8.50% 0.04% 0.00% NA
All Japonica  1512 25.80% 74.20% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 81.50% 18.40% 0.11% 0.00% NA
Indica Intermediate  786 93.80% 6.20% 0.00% 0.00% NA
Temperate Japonica  767 15.50% 84.50% 0.00% 0.00% NA
Tropical Japonica  504 24.20% 75.80% 0.00% 0.00% NA
Japonica Intermediate  241 61.80% 38.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907939520 T -> C LOC_Os09g13630.1 upstream_gene_variant ; 1359.0bp to feature; MODIFIER silent_mutation Average:76.641; most accessible tissue: Zhenshan97 young leaf, score: 88.637 N N N N
vg0907939520 T -> C LOC_Os09g13630-LOC_Os09g13640 intergenic_region ; MODIFIER silent_mutation Average:76.641; most accessible tissue: Zhenshan97 young leaf, score: 88.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907939520 NA 1.07E-19 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 2.35E-14 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 6.59E-20 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 2.96E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 3.99E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 1.69E-10 mr1645_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 2.33E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 3.44E-22 mr1657_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 2.09E-10 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 2.04E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 6.88E-13 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 3.74E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 3.93E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907939520 NA 4.99E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251