Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907776072:

Variant ID: vg0907776072 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7776072
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTATTTTTTTACTATTAATAGTCAAAGTTGAAAATGTTTGACTTGTCACTATGCTAAAAATGCTTATATTTTGGGATGAAGGGAGTATTCAATTTCA[A/C]
GCACGAAGCAGGTTTTGAAATTTCCAAACCCCCCCCCCCCAACCGGTAAGATCATATCTCACCCAAAATTTTCCATTTTATGCAATTTTTTGTGATTTTT

Reverse complement sequence

AAAAATCACAAAAAATTGCATAAAATGGAAAATTTTGGGTGAGATATGATCTTACCGGTTGGGGGGGGGGGGTTTGGAAATTTCAAAACCTGCTTCGTGC[T/G]
TGAAATTGAATACTCCCTTCATCCCAAAATATAAGCATTTTTAGCATAGTGACAAGTCAAACATTTTCAACTTTGACTATTAATAGTAAAAAAATAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	36.40%	0.25%	2.60%	NA
All Indica	2759	84.10%	15.40%	0.29%	0.22%	NA
All Japonica	1512	32.10%	61.20%	0.20%	6.48%	NA
Aus	269	5.60%	87.40%	0.00%	7.06%	NA
Indica I	595	90.30%	9.70%	0.00%	0.00%	NA
Indica II	465	89.90%	10.10%	0.00%	0.00%	NA
Indica III	913	80.60%	19.20%	0.22%	0.00%	NA
Indica Intermediate	786	80.20%	18.30%	0.76%	0.76%	NA
Temperate Japonica	767	56.60%	33.40%	0.13%	9.91%	NA
Tropical Japonica	504	2.40%	94.00%	0.20%	3.37%	NA
Japonica Intermediate	241	16.60%	80.90%	0.41%	2.07%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	51.10%	47.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907776072	A -> DEL	N	N	silent_mutation	Average:25.503; most accessible tissue: Callus, score: 35.373	N	N	N	N
vg0907776072	A -> C	LOC_Os09g13450.1	upstream_gene_variant ; 3288.0bp to feature; MODIFIER	silent_mutation	Average:25.503; most accessible tissue: Callus, score: 35.373	N	N	N	N
vg0907776072	A -> C	LOC_Os09g13430.1	downstream_gene_variant ; 2904.0bp to feature; MODIFIER	silent_mutation	Average:25.503; most accessible tissue: Callus, score: 35.373	N	N	N	N
vg0907776072	A -> C	LOC_Os09g13440.1	intron_variant ; MODIFIER	silent_mutation	Average:25.503; most accessible tissue: Callus, score: 35.373	N	N	N	N
vg0907776072	A -> C	LOC_Os09g13440.2	intron_variant ; MODIFIER	silent_mutation	Average:25.503; most accessible tissue: Callus, score: 35.373	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907776072	NA	2.93E-21	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0907776072	NA	1.10E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	3.84E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	5.89E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	1.54E-06	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	2.37E-08	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	3.72E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	6.13E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	4.64E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	5.93E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	5.60E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	2.26E-06	2.26E-06	mr1568_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	4.60E-06	mr1621_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907776072	NA	4.01E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251