\
| Variant ID: vg0907770893 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7770893 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.29, others allele: 0.00, population size: 68. )
TCCGCAGCCCAACATGACTGTACTCCTACTCTGTAATAAAGAGACCTCTGTTGCTGTGATATTCTGTCTTCCTGTGATACCAGCACTGTTTCCTGGGACT[A/G]
ATATCGATAAACAGGTTAATTTGGAGCGTCACGGGCTAGTTCCGTTCGGGGCTAGTTCGGGGCATGACACCCTGGCAATGCGTAGATACACAGGGCCGAG
CTCGGCCCTGTGTATCTACGCATTGCCAGGGTGTCATGCCCCGAACTAGCCCCGAACGGAACTAGCCCGTGACGCTCCAAATTAACCTGTTTATCGATAT[T/C]
AGTCCCAGGAAACAGTGCTGGTATCACAGGAAGACAGAATATCACAGCAACAGAGGTCTCTTTATTACAGAGTAGGAGTACAGTCATGTTGGGCTGCGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.60% | 21.50% | 4.93% | 21.03% | NA |
| All Indica | 2759 | 79.40% | 2.90% | 7.50% | 10.18% | NA |
| All Japonica | 1512 | 2.10% | 60.10% | 0.86% | 36.90% | NA |
| Aus | 269 | 82.50% | 0.00% | 0.74% | 16.73% | NA |
| Indica I | 595 | 68.70% | 3.20% | 13.45% | 14.62% | NA |
| Indica II | 465 | 81.10% | 1.30% | 9.46% | 8.17% | NA |
| Indica III | 913 | 86.90% | 1.60% | 3.07% | 8.43% | NA |
| Indica Intermediate | 786 | 78.00% | 5.00% | 7.00% | 10.05% | NA |
| Temperate Japonica | 767 | 2.90% | 78.40% | 0.26% | 18.51% | NA |
| Tropical Japonica | 504 | 1.20% | 25.40% | 1.79% | 71.63% | NA |
| Japonica Intermediate | 241 | 1.70% | 74.70% | 0.83% | 22.82% | NA |
| VI/Aromatic | 96 | 5.20% | 1.00% | 2.08% | 91.67% | NA |
| Intermediate | 90 | 36.70% | 28.90% | 10.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907770893 | A -> G | LOC_Os09g13430.1 | missense_variant ; p.Asn30Asp; MODERATE | nonsynonymous_codon | Average:15.146; most accessible tissue: Zhenshan97 root, score: 22.162 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0907770893 | A -> DEL | LOC_Os09g13430.1 | N | frameshift_variant | Average:15.146; most accessible tissue: Zhenshan97 root, score: 22.162 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907770893 | NA | 1.69E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 1.81E-23 | mr1102 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 4.04E-10 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 1.05E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 9.27E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 4.83E-17 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 1.45E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 4.04E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 8.30E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 6.62E-13 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 4.59E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 1.08E-06 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 5.66E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 2.83E-14 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 1.28E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907770893 | NA | 4.78E-16 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |