Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0907746354:

Variant ID: vg0907746354 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7746354
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGTGGGACAAATGCTTCTGTATGAAAAAGAAGTCTTTTAGAGACGGAAGAAGTATACCACAATAATTAAGTGGATATATTATAAAAATCGATCACTA[C/T]
CATAGAACACCACATCCAGACCGCCTCATTAGTATCGGTTATCCAAAAACTAACATTTATAGTGGTTCCAAACCCCCTTAGATTGCACGCATTCTTAATG

Reverse complement sequence

CATTAAGAATGCGTGCAATCTAAGGGGGTTTGGAACCACTATAAATGTTAGTTTTTGGATAACCGATACTAATGAGGCGGTCTGGATGTGGTGTTCTATG[G/A]
TAGTGATCGATTTTTATAATATATCCACTTAATTATTGTGGTATACTTCTTCCGTCTCTAAAAGACTTCTTTTTCATACAGAAGCATTTGTCCCACAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.70%	40.10%	0.78%	0.44%	NA
All Indica	2759	88.40%	9.70%	1.16%	0.72%	NA
All Japonica	1512	4.30%	95.60%	0.13%	0.00%	NA
Aus	269	87.70%	11.20%	0.74%	0.37%	NA
Indica I	595	84.70%	11.40%	2.02%	1.85%	NA
Indica II	465	95.10%	4.90%	0.00%	0.00%	NA
Indica III	913	89.80%	8.10%	1.31%	0.77%	NA
Indica Intermediate	786	85.60%	13.10%	1.02%	0.25%	NA
Temperate Japonica	767	6.80%	93.00%	0.26%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	5.20%	94.80%	0.00%	0.00%	NA
Intermediate	90	33.30%	65.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907746354	C -> DEL	N	N	silent_mutation	Average:50.068; most accessible tissue: Minghui63 root, score: 72.958	N	N	N	N
vg0907746354	C -> T	LOC_Os09g13400.1	upstream_gene_variant ; 2383.0bp to feature; MODIFIER	silent_mutation	Average:50.068; most accessible tissue: Minghui63 root, score: 72.958	N	N	N	N
vg0907746354	C -> T	LOC_Os09g13400-LOC_Os09g13410	intergenic_region ; MODIFIER	silent_mutation	Average:50.068; most accessible tissue: Minghui63 root, score: 72.958	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907746354	NA	4.81E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354	NA	1.15E-12	mr1239	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354	NA	2.26E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354	NA	2.35E-15	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354	NA	5.21E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354	NA	9.86E-15	mr1579	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354	NA	2.18E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354	NA	9.24E-26	mr1686	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354	NA	7.57E-15	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354	NA	3.01E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251