| Variant ID: vg0907746354 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7746354 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 80. )
TTTTGTGGGACAAATGCTTCTGTATGAAAAAGAAGTCTTTTAGAGACGGAAGAAGTATACCACAATAATTAAGTGGATATATTATAAAAATCGATCACTA[C/T]
CATAGAACACCACATCCAGACCGCCTCATTAGTATCGGTTATCCAAAAACTAACATTTATAGTGGTTCCAAACCCCCTTAGATTGCACGCATTCTTAATG
CATTAAGAATGCGTGCAATCTAAGGGGGTTTGGAACCACTATAAATGTTAGTTTTTGGATAACCGATACTAATGAGGCGGTCTGGATGTGGTGTTCTATG[G/A]
TAGTGATCGATTTTTATAATATATCCACTTAATTATTGTGGTATACTTCTTCCGTCTCTAAAAGACTTCTTTTTCATACAGAAGCATTTGTCCCACAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.70% | 40.10% | 0.78% | 0.44% | NA |
| All Indica | 2759 | 88.40% | 9.70% | 1.16% | 0.72% | NA |
| All Japonica | 1512 | 4.30% | 95.60% | 0.13% | 0.00% | NA |
| Aus | 269 | 87.70% | 11.20% | 0.74% | 0.37% | NA |
| Indica I | 595 | 84.70% | 11.40% | 2.02% | 1.85% | NA |
| Indica II | 465 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.80% | 8.10% | 1.31% | 0.77% | NA |
| Indica Intermediate | 786 | 85.60% | 13.10% | 1.02% | 0.25% | NA |
| Temperate Japonica | 767 | 6.80% | 93.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 33.30% | 65.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907746354 | C -> DEL | N | N | silent_mutation | Average:50.068; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| vg0907746354 | C -> T | LOC_Os09g13400.1 | upstream_gene_variant ; 2383.0bp to feature; MODIFIER | silent_mutation | Average:50.068; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| vg0907746354 | C -> T | LOC_Os09g13400-LOC_Os09g13410 | intergenic_region ; MODIFIER | silent_mutation | Average:50.068; most accessible tissue: Minghui63 root, score: 72.958 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907746354 | NA | 4.81E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907746354 | NA | 1.15E-12 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907746354 | NA | 2.26E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907746354 | NA | 2.35E-15 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907746354 | NA | 5.21E-10 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907746354 | NA | 9.86E-15 | mr1579 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907746354 | NA | 2.18E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907746354 | NA | 9.24E-26 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907746354 | NA | 7.57E-15 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907746354 | NA | 3.01E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |