\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907746354:

Variant ID: vg0907746354 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7746354
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGTGGGACAAATGCTTCTGTATGAAAAAGAAGTCTTTTAGAGACGGAAGAAGTATACCACAATAATTAAGTGGATATATTATAAAAATCGATCACTA[C/T]
CATAGAACACCACATCCAGACCGCCTCATTAGTATCGGTTATCCAAAAACTAACATTTATAGTGGTTCCAAACCCCCTTAGATTGCACGCATTCTTAATG

Reverse complement sequence

CATTAAGAATGCGTGCAATCTAAGGGGGTTTGGAACCACTATAAATGTTAGTTTTTGGATAACCGATACTAATGAGGCGGTCTGGATGTGGTGTTCTATG[G/A]
TAGTGATCGATTTTTATAATATATCCACTTAATTATTGTGGTATACTTCTTCCGTCTCTAAAAGACTTCTTTTTCATACAGAAGCATTTGTCCCACAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 40.10% 0.78% 0.44% NA
All Indica  2759 88.40% 9.70% 1.16% 0.72% NA
All Japonica  1512 4.30% 95.60% 0.13% 0.00% NA
Aus  269 87.70% 11.20% 0.74% 0.37% NA
Indica I  595 84.70% 11.40% 2.02% 1.85% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 89.80% 8.10% 1.31% 0.77% NA
Indica Intermediate  786 85.60% 13.10% 1.02% 0.25% NA
Temperate Japonica  767 6.80% 93.00% 0.26% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907746354 C -> DEL N N silent_mutation Average:50.068; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg0907746354 C -> T LOC_Os09g13400.1 upstream_gene_variant ; 2383.0bp to feature; MODIFIER silent_mutation Average:50.068; most accessible tissue: Minghui63 root, score: 72.958 N N N N
vg0907746354 C -> T LOC_Os09g13400-LOC_Os09g13410 intergenic_region ; MODIFIER silent_mutation Average:50.068; most accessible tissue: Minghui63 root, score: 72.958 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907746354 NA 4.81E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354 NA 1.15E-12 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354 NA 2.26E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354 NA 2.35E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354 NA 5.21E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354 NA 9.86E-15 mr1579 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354 NA 2.18E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354 NA 9.24E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354 NA 7.57E-15 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746354 NA 3.01E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251