\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907678745:

Variant ID: vg0907678745 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7678745
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.13, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTCAAATGGGAATATGGTCAACAACAAAGTTGATCCTCTCATCAAGATCTACAACTTTTATTTTGGTCACTTCTTCATCCGACAAAGTGATAGTTATA[T/C]
TATTCACAATAATCACATTTCTCTCATCTGGTTTATAAATATGAACACAGATATGTCAATTTTCTGTAAACATTGGTACTATCACTTTGTCGGATGAAGA

Reverse complement sequence

TCTTCATCCGACAAAGTGATAGTACCAATGTTTACAGAAAATTGACATATCTGTGTTCATATTTATAAACCAGATGAGAGAAATGTGATTATTGTGAATA[A/G]
TATAACTATCACTTTGTCGGATGAAGAAGTGACCAAAATAAAAGTTGTAGATCTTGATGAGAGGATCAACTTTGTTGTTGACCATATTCCCATTTGAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 42.90% 11.07% 3.00% NA
All Indica  2759 18.30% 63.50% 17.25% 0.91% NA
All Japonica  1512 87.80% 2.60% 2.05% 7.61% NA
Aus  269 17.10% 79.90% 2.97% 0.00% NA
Indica I  595 17.10% 48.70% 32.44% 1.68% NA
Indica II  465 10.50% 64.70% 22.58% 2.15% NA
Indica III  913 21.90% 73.70% 4.38% 0.00% NA
Indica Intermediate  786 19.70% 62.10% 17.56% 0.64% NA
Temperate Japonica  767 78.40% 3.90% 3.26% 14.47% NA
Tropical Japonica  504 98.60% 1.20% 0.20% 0.00% NA
Japonica Intermediate  241 95.00% 1.20% 2.07% 1.66% NA
VI/Aromatic  96 92.70% 6.20% 1.04% 0.00% NA
Intermediate  90 71.10% 18.90% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907678745 T -> DEL N N silent_mutation Average:14.457; most accessible tissue: Callus, score: 37.283 N N N N
vg0907678745 T -> C LOC_Os09g13310.1 downstream_gene_variant ; 1668.0bp to feature; MODIFIER silent_mutation Average:14.457; most accessible tissue: Callus, score: 37.283 N N N N
vg0907678745 T -> C LOC_Os09g13320.1 downstream_gene_variant ; 1239.0bp to feature; MODIFIER silent_mutation Average:14.457; most accessible tissue: Callus, score: 37.283 N N N N
vg0907678745 T -> C LOC_Os09g13310-LOC_Os09g13320 intergenic_region ; MODIFIER silent_mutation Average:14.457; most accessible tissue: Callus, score: 37.283 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907678745 NA 3.37E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907678745 NA 4.85E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907678745 4.32E-06 6.43E-06 mr1631_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907678745 NA 4.00E-07 mr1851_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907678745 NA 9.76E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251