\
| Variant ID: vg0907678745 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7678745 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.13, others allele: 0.00, population size: 63. )
ATTTCAAATGGGAATATGGTCAACAACAAAGTTGATCCTCTCATCAAGATCTACAACTTTTATTTTGGTCACTTCTTCATCCGACAAAGTGATAGTTATA[T/C]
TATTCACAATAATCACATTTCTCTCATCTGGTTTATAAATATGAACACAGATATGTCAATTTTCTGTAAACATTGGTACTATCACTTTGTCGGATGAAGA
TCTTCATCCGACAAAGTGATAGTACCAATGTTTACAGAAAATTGACATATCTGTGTTCATATTTATAAACCAGATGAGAGAAATGTGATTATTGTGAATA[A/G]
TATAACTATCACTTTGTCGGATGAAGAAGTGACCAAAATAAAAGTTGTAGATCTTGATGAGAGGATCAACTTTGTTGTTGACCATATTCCCATTTGAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.00% | 42.90% | 11.07% | 3.00% | NA |
| All Indica | 2759 | 18.30% | 63.50% | 17.25% | 0.91% | NA |
| All Japonica | 1512 | 87.80% | 2.60% | 2.05% | 7.61% | NA |
| Aus | 269 | 17.10% | 79.90% | 2.97% | 0.00% | NA |
| Indica I | 595 | 17.10% | 48.70% | 32.44% | 1.68% | NA |
| Indica II | 465 | 10.50% | 64.70% | 22.58% | 2.15% | NA |
| Indica III | 913 | 21.90% | 73.70% | 4.38% | 0.00% | NA |
| Indica Intermediate | 786 | 19.70% | 62.10% | 17.56% | 0.64% | NA |
| Temperate Japonica | 767 | 78.40% | 3.90% | 3.26% | 14.47% | NA |
| Tropical Japonica | 504 | 98.60% | 1.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 1.20% | 2.07% | 1.66% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 18.90% | 7.78% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907678745 | T -> DEL | N | N | silent_mutation | Average:14.457; most accessible tissue: Callus, score: 37.283 | N | N | N | N |
| vg0907678745 | T -> C | LOC_Os09g13310.1 | downstream_gene_variant ; 1668.0bp to feature; MODIFIER | silent_mutation | Average:14.457; most accessible tissue: Callus, score: 37.283 | N | N | N | N |
| vg0907678745 | T -> C | LOC_Os09g13320.1 | downstream_gene_variant ; 1239.0bp to feature; MODIFIER | silent_mutation | Average:14.457; most accessible tissue: Callus, score: 37.283 | N | N | N | N |
| vg0907678745 | T -> C | LOC_Os09g13310-LOC_Os09g13320 | intergenic_region ; MODIFIER | silent_mutation | Average:14.457; most accessible tissue: Callus, score: 37.283 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907678745 | NA | 3.37E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907678745 | NA | 4.85E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907678745 | 4.32E-06 | 6.43E-06 | mr1631_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907678745 | NA | 4.00E-07 | mr1851_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907678745 | NA | 9.76E-06 | mr1882_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |