\
| Variant ID: vg0907175556 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7175556 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 115. )
TGTATATGAGCGTCTTCTCTCTTACCGACTCTGATCAGTCAGTTTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTTATCGTCGGAGAATCATTCTCG[A/G]
AAGATAAGGCTCTTAGACCTTTGACCTGCCTCGGTTGAACAAGCACTGATCCTAGCCCCCAGCCATGAAGTTGGAAAACTCAATTTCCGATTACACGGCT
AGCCGTGTAATCGGAAATTGAGTTTTCCAACTTCATGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCGAGGCAGGTCAAAGGTCTAAGAGCCTTATCTT[T/C]
CGAGAATGATTCTCCGACGATAAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAAACTGACTGATCAGAGTCGGTAAGAGAGAAGACGCTCATATACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.50% | 27.10% | 5.90% | 30.53% | NA |
| All Indica | 2759 | 39.30% | 2.70% | 7.76% | 50.24% | NA |
| All Japonica | 1512 | 27.20% | 70.90% | 1.52% | 0.40% | NA |
| Aus | 269 | 59.50% | 12.60% | 13.75% | 14.13% | NA |
| Indica I | 595 | 36.00% | 1.80% | 6.89% | 55.29% | NA |
| Indica II | 465 | 28.60% | 2.40% | 9.68% | 59.35% | NA |
| Indica III | 913 | 46.40% | 2.30% | 7.67% | 43.59% | NA |
| Indica Intermediate | 786 | 39.80% | 4.10% | 7.38% | 48.73% | NA |
| Temperate Japonica | 767 | 27.00% | 70.10% | 2.61% | 0.26% | NA |
| Tropical Japonica | 504 | 17.70% | 81.30% | 0.40% | 0.60% | NA |
| Japonica Intermediate | 241 | 47.70% | 51.50% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 39.60% | 56.20% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 34.40% | 50.00% | 2.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907175556 | A -> G | LOC_Os09g12530.1 | upstream_gene_variant ; 4407.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175556 | A -> G | LOC_Os09g12500.1 | downstream_gene_variant ; 4170.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175556 | A -> G | LOC_Os09g12510.1 | downstream_gene_variant ; 1963.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175556 | A -> G | LOC_Os09g12520.1 | downstream_gene_variant ; 952.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175556 | A -> G | LOC_Os09g12500.2 | downstream_gene_variant ; 4170.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175556 | A -> G | LOC_Os09g12510-LOC_Os09g12520 | intergenic_region ; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175556 | A -> DEL | N | N | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907175556 | NA | 7.67E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 8.21E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 2.38E-07 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 6.68E-06 | mr1337_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 4.84E-07 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 2.20E-06 | mr1391_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | 2.32E-06 | NA | mr1442_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 6.40E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | 3.22E-06 | NA | mr1550_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 6.82E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | 4.25E-06 | 3.74E-06 | mr1637_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 3.04E-10 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | 9.18E-06 | 9.18E-06 | mr1819_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 4.50E-06 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | 4.21E-06 | 4.21E-06 | mr1891_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175556 | NA | 1.89E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |