\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907175556:

Variant ID: vg0907175556 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7175556
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TGTATATGAGCGTCTTCTCTCTTACCGACTCTGATCAGTCAGTTTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTTATCGTCGGAGAATCATTCTCG[A/G]
AAGATAAGGCTCTTAGACCTTTGACCTGCCTCGGTTGAACAAGCACTGATCCTAGCCCCCAGCCATGAAGTTGGAAAACTCAATTTCCGATTACACGGCT

Reverse complement sequence

AGCCGTGTAATCGGAAATTGAGTTTTCCAACTTCATGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCGAGGCAGGTCAAAGGTCTAAGAGCCTTATCTT[T/C]
CGAGAATGATTCTCCGACGATAAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAAACTGACTGATCAGAGTCGGTAAGAGAGAAGACGCTCATATACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.50% 27.10% 5.90% 30.53% NA
All Indica  2759 39.30% 2.70% 7.76% 50.24% NA
All Japonica  1512 27.20% 70.90% 1.52% 0.40% NA
Aus  269 59.50% 12.60% 13.75% 14.13% NA
Indica I  595 36.00% 1.80% 6.89% 55.29% NA
Indica II  465 28.60% 2.40% 9.68% 59.35% NA
Indica III  913 46.40% 2.30% 7.67% 43.59% NA
Indica Intermediate  786 39.80% 4.10% 7.38% 48.73% NA
Temperate Japonica  767 27.00% 70.10% 2.61% 0.26% NA
Tropical Japonica  504 17.70% 81.30% 0.40% 0.60% NA
Japonica Intermediate  241 47.70% 51.50% 0.41% 0.41% NA
VI/Aromatic  96 39.60% 56.20% 3.12% 1.04% NA
Intermediate  90 34.40% 50.00% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907175556 A -> G LOC_Os09g12530.1 upstream_gene_variant ; 4407.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175556 A -> G LOC_Os09g12500.1 downstream_gene_variant ; 4170.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175556 A -> G LOC_Os09g12510.1 downstream_gene_variant ; 1963.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175556 A -> G LOC_Os09g12520.1 downstream_gene_variant ; 952.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175556 A -> G LOC_Os09g12500.2 downstream_gene_variant ; 4170.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175556 A -> G LOC_Os09g12510-LOC_Os09g12520 intergenic_region ; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175556 A -> DEL N N silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907175556 NA 7.67E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 8.21E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 2.38E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 6.68E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 4.84E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 2.20E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 2.32E-06 NA mr1442_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 6.40E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 3.22E-06 NA mr1550_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 6.82E-07 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 4.25E-06 3.74E-06 mr1637_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 3.04E-10 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 9.18E-06 9.18E-06 mr1819_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 4.50E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 4.21E-06 4.21E-06 mr1891_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556 NA 1.89E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251