Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0907175556:

Variant ID: vg0907175556 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7175556
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TGTATATGAGCGTCTTCTCTCTTACCGACTCTGATCAGTCAGTTTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTTATCGTCGGAGAATCATTCTCG[A/G]
AAGATAAGGCTCTTAGACCTTTGACCTGCCTCGGTTGAACAAGCACTGATCCTAGCCCCCAGCCATGAAGTTGGAAAACTCAATTTCCGATTACACGGCT

Reverse complement sequence

AGCCGTGTAATCGGAAATTGAGTTTTCCAACTTCATGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCGAGGCAGGTCAAAGGTCTAAGAGCCTTATCTT[T/C]
CGAGAATGATTCTCCGACGATAAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAAACTGACTGATCAGAGTCGGTAAGAGAGAAGACGCTCATATACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.50%	27.10%	5.90%	30.53%	NA
All Indica	2759	39.30%	2.70%	7.76%	50.24%	NA
All Japonica	1512	27.20%	70.90%	1.52%	0.40%	NA
Aus	269	59.50%	12.60%	13.75%	14.13%	NA
Indica I	595	36.00%	1.80%	6.89%	55.29%	NA
Indica II	465	28.60%	2.40%	9.68%	59.35%	NA
Indica III	913	46.40%	2.30%	7.67%	43.59%	NA
Indica Intermediate	786	39.80%	4.10%	7.38%	48.73%	NA
Temperate Japonica	767	27.00%	70.10%	2.61%	0.26%	NA
Tropical Japonica	504	17.70%	81.30%	0.40%	0.60%	NA
Japonica Intermediate	241	47.70%	51.50%	0.41%	0.41%	NA
VI/Aromatic	96	39.60%	56.20%	3.12%	1.04%	NA
Intermediate	90	34.40%	50.00%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907175556	A -> G	LOC_Os09g12530.1	upstream_gene_variant ; 4407.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175556	A -> G	LOC_Os09g12500.1	downstream_gene_variant ; 4170.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175556	A -> G	LOC_Os09g12510.1	downstream_gene_variant ; 1963.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175556	A -> G	LOC_Os09g12520.1	downstream_gene_variant ; 952.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175556	A -> G	LOC_Os09g12500.2	downstream_gene_variant ; 4170.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175556	A -> G	LOC_Os09g12510-LOC_Os09g12520	intergenic_region ; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175556	A -> DEL	N	N	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907175556	NA	7.67E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	8.21E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	2.38E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	6.68E-06	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	4.84E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	2.20E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	2.32E-06	NA	mr1442_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	6.40E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	3.22E-06	NA	mr1550_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	6.82E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	4.25E-06	3.74E-06	mr1637_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	3.04E-10	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	9.18E-06	9.18E-06	mr1819_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	4.50E-06	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	4.21E-06	4.21E-06	mr1891_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175556	NA	1.89E-06	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251