\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907138440:

Variant ID: vg0907138440 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7138440
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.48, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAAGTGAATAACTTGGATCAAATACATGCATAACTAATATATAGGATTTGCTCCCCCTAAATGTATGCATACGAAAAATTTGTGTGAAGCAAGAGTAT[A/G]
CATAACAAAATATGAAAAATTGAGAGCTTATCCTATACAAGAATAGAAGGCATTTATCAATATAGACATTAAAATAAAAGCATACATTCATCATCTCCAT

Reverse complement sequence

ATGGAGATGATGAATGTATGCTTTTATTTTAATGTCTATATTGATAAATGCCTTCTATTCTTGTATAGGATAAGCTCTCAATTTTTCATATTTTGTTATG[T/C]
ATACTCTTGCTTCACACAAATTTTTCGTATGCATACATTTAGGGGGAGCAAATCCTATATATTAGTTATGCATGTATTTGATCCAAGTTATTCACTTTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.70% 19.50% 1.29% 9.56% NA
All Indica  2759 67.70% 20.90% 0.65% 10.76% NA
All Japonica  1512 86.20% 1.50% 2.58% 9.72% NA
Aus  269 10.80% 87.70% 0.37% 1.12% NA
Indica I  595 47.90% 50.30% 0.17% 1.68% NA
Indica II  465 84.50% 12.30% 0.22% 3.01% NA
Indica III  913 66.50% 5.80% 1.53% 26.18% NA
Indica Intermediate  786 74.00% 21.40% 0.25% 4.33% NA
Temperate Japonica  767 96.10% 1.20% 0.39% 2.35% NA
Tropical Japonica  504 84.10% 1.00% 2.78% 12.10% NA
Japonica Intermediate  241 58.90% 3.70% 9.13% 28.22% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 72.20% 18.90% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907138440 A -> G LOC_Os09g12480.1 intron_variant ; MODIFIER silent_mutation Average:26.362; most accessible tissue: Callus, score: 39.17 N N N N
vg0907138440 A -> DEL N N silent_mutation Average:26.362; most accessible tissue: Callus, score: 39.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907138440 NA 1.65E-06 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907138440 NA 1.43E-06 mr1610 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907138440 NA 6.63E-07 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907138440 3.54E-06 NA mr1927 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907138440 NA 1.53E-07 mr1927 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907138440 NA 2.26E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907138440 NA 3.12E-08 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251