\
| Variant ID: vg0907138440 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7138440 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.52, G: 0.48, others allele: 0.00, population size: 84. )
TGAAAGTGAATAACTTGGATCAAATACATGCATAACTAATATATAGGATTTGCTCCCCCTAAATGTATGCATACGAAAAATTTGTGTGAAGCAAGAGTAT[A/G]
CATAACAAAATATGAAAAATTGAGAGCTTATCCTATACAAGAATAGAAGGCATTTATCAATATAGACATTAAAATAAAAGCATACATTCATCATCTCCAT
ATGGAGATGATGAATGTATGCTTTTATTTTAATGTCTATATTGATAAATGCCTTCTATTCTTGTATAGGATAAGCTCTCAATTTTTCATATTTTGTTATG[T/C]
ATACTCTTGCTTCACACAAATTTTTCGTATGCATACATTTAGGGGGAGCAAATCCTATATATTAGTTATGCATGTATTTGATCCAAGTTATTCACTTTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.70% | 19.50% | 1.29% | 9.56% | NA |
| All Indica | 2759 | 67.70% | 20.90% | 0.65% | 10.76% | NA |
| All Japonica | 1512 | 86.20% | 1.50% | 2.58% | 9.72% | NA |
| Aus | 269 | 10.80% | 87.70% | 0.37% | 1.12% | NA |
| Indica I | 595 | 47.90% | 50.30% | 0.17% | 1.68% | NA |
| Indica II | 465 | 84.50% | 12.30% | 0.22% | 3.01% | NA |
| Indica III | 913 | 66.50% | 5.80% | 1.53% | 26.18% | NA |
| Indica Intermediate | 786 | 74.00% | 21.40% | 0.25% | 4.33% | NA |
| Temperate Japonica | 767 | 96.10% | 1.20% | 0.39% | 2.35% | NA |
| Tropical Japonica | 504 | 84.10% | 1.00% | 2.78% | 12.10% | NA |
| Japonica Intermediate | 241 | 58.90% | 3.70% | 9.13% | 28.22% | NA |
| VI/Aromatic | 96 | 30.20% | 69.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 18.90% | 3.33% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907138440 | A -> G | LOC_Os09g12480.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.362; most accessible tissue: Callus, score: 39.17 | N | N | N | N |
| vg0907138440 | A -> DEL | N | N | silent_mutation | Average:26.362; most accessible tissue: Callus, score: 39.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907138440 | NA | 1.65E-06 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907138440 | NA | 1.43E-06 | mr1610 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907138440 | NA | 6.63E-07 | mr1914 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907138440 | 3.54E-06 | NA | mr1927 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907138440 | NA | 1.53E-07 | mr1927 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907138440 | NA | 2.26E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907138440 | NA | 3.12E-08 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |