\
| Variant ID: vg0907029568 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7029568 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 85. )
TTCTCTGGATTGAGCATGAGGCGATATTGTCGGAGGTTGTCGAACGTTTCCCGCAGATCGTCAATCAATGAGTCGCTTGTCTTGGTCTTGACAACGATAT[T/C]
GTCGACGTAGGCGTCGACATTGTTGCTGAGCTGGTCGCTAAGTGCGCACTGGACCGTGCGCTGGAAAGTATTCCCTGCGGTTATTAGTCCGAACGGCATC
GATGCCGTTCGGACTAATAACCGCAGGGAATACTTTCCAGCGCACGGTCCAGTGCGCACTTAGCGACCAGCTCAGCAACAATGTCGACGCCTACGTCGAC[A/G]
ATATCGTTGTCAAGACCAAGACAAGCGACTCATTGATTGACGATCTGCGGGAAACGTTCGACAACCTCCGACAATATCGCCTCATGCTCAATCCAGAGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.30% | 6.10% | 15.13% | 52.39% | NA |
| All Indica | 2759 | 1.80% | 1.30% | 15.80% | 81.04% | NA |
| All Japonica | 1512 | 75.30% | 15.70% | 8.07% | 0.99% | NA |
| Aus | 269 | 0.40% | 2.20% | 26.77% | 70.63% | NA |
| Indica I | 595 | 2.50% | 0.30% | 5.04% | 92.10% | NA |
| Indica II | 465 | 0.60% | 3.40% | 9.89% | 86.02% | NA |
| Indica III | 913 | 0.50% | 0.40% | 31.54% | 67.47% | NA |
| Indica Intermediate | 786 | 3.60% | 1.80% | 9.16% | 85.50% | NA |
| Temperate Japonica | 767 | 92.40% | 5.00% | 1.96% | 0.65% | NA |
| Tropical Japonica | 504 | 63.10% | 19.60% | 15.67% | 1.59% | NA |
| Japonica Intermediate | 241 | 46.10% | 41.50% | 11.62% | 0.83% | NA |
| VI/Aromatic | 96 | 21.90% | 5.20% | 68.75% | 4.17% | NA |
| Intermediate | 90 | 37.80% | 6.70% | 21.11% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907029568 | T -> DEL | LOC_Os09g12330.1 | N | frameshift_variant | Average:18.83; most accessible tissue: Callus, score: 29.521 | N | N | N | N |
| vg0907029568 | T -> C | LOC_Os09g12330.1 | missense_variant ; p.Asn406Asp; MODERATE | nonsynonymous_codon | Average:18.83; most accessible tissue: Callus, score: 29.521 | benign |
-0.587 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907029568 | 8.31E-08 | NA | mr1092 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 8.78E-21 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 5.62E-19 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 3.42E-18 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | 7.61E-06 | NA | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 1.56E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 1.85E-15 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 5.97E-26 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 7.36E-18 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 8.43E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 9.54E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907029568 | NA | 9.38E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |