\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907026290:

Variant ID: vg0907026290 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7026290
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGCTTGCCTATGAGATCATCGCCCGCGCCTGGACCTCGATTTTCTCCGTGAGGGTTTTGTTCGTTCTCGGAAAACTCCAGCTGAGATAGATCACCTGG[C/T]
GAGGTCGATGGCGCCGTTGGCGGAGAAGATGTTCCAGTCTATGGATTGGCGTTGGCCTTCTTGGTAATCTTCGTACCCTGTGATAGATATCTCAGGAAAA

Reverse complement sequence

TTTTCCTGAGATATCTATCACAGGGTACGAAGATTACCAAGAAGGCCAACGCCAATCCATAGACTGGAACATCTTCTCCGCCAACGGCGCCATCGACCTC[G/A]
CCAGGTGATCTATCTCAGCTGGAGTTTTCCGAGAACGAACAAAACCCTCACGGAGAAAATCGAGGTCCAGGCGCGGGCGATGATCTCATAGGCAAGCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 5.30% 0.47% 1.99% NA
All Indica  2759 95.80% 1.50% 0.43% 2.28% NA
All Japonica  1512 98.90% 0.90% 0.00% 0.20% NA
Aus  269 32.30% 54.30% 3.35% 10.04% NA
Indica I  595 93.60% 0.00% 0.50% 5.88% NA
Indica II  465 98.50% 0.00% 0.65% 0.86% NA
Indica III  913 99.30% 0.40% 0.11% 0.11% NA
Indica Intermediate  786 91.70% 4.70% 0.64% 2.93% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 40.60% 1.04% 0.00% NA
Intermediate  90 88.90% 10.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907026290 C -> DEL N N silent_mutation Average:48.749; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0907026290 C -> T LOC_Os09g12320.1 downstream_gene_variant ; 128.0bp to feature; MODIFIER silent_mutation Average:48.749; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0907026290 C -> T LOC_Os09g12330.1 downstream_gene_variant ; 685.0bp to feature; MODIFIER silent_mutation Average:48.749; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N
vg0907026290 C -> T LOC_Os09g12320-LOC_Os09g12330 intergenic_region ; MODIFIER silent_mutation Average:48.749; most accessible tissue: Zhenshan97 flag leaf, score: 67.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907026290 NA 1.64E-28 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 1.33E-06 2.85E-27 mr1101 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 NA 2.24E-18 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 5.18E-06 1.76E-20 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 NA 1.77E-20 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 NA 1.15E-18 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 7.26E-07 8.68E-27 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 1.06E-08 3.24E-21 mr1242 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 2.62E-06 3.45E-24 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 NA 2.00E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 6.61E-08 6.06E-20 mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 NA 6.88E-22 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 7.65E-06 3.86E-25 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 7.48E-06 3.58E-25 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 7.19E-07 NA mr1917 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 NA 4.90E-18 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 NA 6.37E-20 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 8.91E-07 3.43E-29 mr1098_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 3.96E-06 1.13E-24 mr1099_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 1.48E-07 1.48E-20 mr1113_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 1.82E-08 7.61E-20 mr1114_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 6.95E-07 7.16E-22 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 5.76E-08 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 1.68E-08 6.03E-22 mr1119_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 2.88E-07 4.25E-25 mr1120_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 1.92E-09 4.63E-28 mr1123_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 5.49E-08 NA mr1150_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 NA 7.74E-07 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 2.59E-12 7.87E-27 mr1240_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 1.70E-08 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 2.16E-06 2.84E-24 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 3.67E-06 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 5.67E-07 9.25E-15 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 3.47E-09 4.77E-19 mr1936_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907026290 NA 7.65E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251