\
| Variant ID: vg0906916912 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 6916912 |
| Reference Allele: C | Alternative Allele: T,CAT |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 254. )
CGTGCTATTTTTCCTATACATTTAATTATACGCACCCGCACTATAATATACCGGAGAACTGTTTTAACCAGTAGCTGAATTATCTATGCCGTGCGTCCAC[C/T,CAT]
ATGATACATTACAACTTGTGCGCAAGCATGCACAAAGTATATATTATCAATGCTCTATTTGAATTTGAAACCATACCAAAATTTTTGTAGTACTAAATCT
AGATTTAGTACTACAAAAATTTTGGTATGGTTTCAAATTCAAATAGAGCATTGATAATATATACTTTGTGCATGCTTGCGCACAAGTTGTAATGTATCAT[G/A,ATG]
GTGGACGCACGGCATAGATAATTCAGCTACTGGTTAAAACAGTTCTCCGGTATATTATAGTGCGGGTGCGTATAATTAAATGTATAGGAAAAATAGCACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 7.80% | 0.63% | 0.00% | CAT: 0.02% |
| All Indica | 2759 | 99.50% | 0.40% | 0.07% | 0.00% | CAT: 0.04% |
| All Japonica | 1512 | 75.50% | 22.60% | 1.85% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.40% | 0.00% | 0.00% | CAT: 0.11% |
| Indica Intermediate | 786 | 99.00% | 0.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 91.90% | 6.00% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 49.20% | 48.60% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 21.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906916912 | C -> T | LOC_Os09g12210.1 | upstream_gene_variant ; 1158.0bp to feature; MODIFIER | silent_mutation | Average:48.439; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| vg0906916912 | C -> T | LOC_Os09g12200-LOC_Os09g12210 | intergenic_region ; MODIFIER | silent_mutation | Average:48.439; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| vg0906916912 | C -> CAT | LOC_Os09g12210.1 | upstream_gene_variant ; 1157.0bp to feature; MODIFIER | silent_mutation | Average:48.439; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| vg0906916912 | C -> CAT | LOC_Os09g12200-LOC_Os09g12210 | intergenic_region ; MODIFIER | silent_mutation | Average:48.439; most accessible tissue: Zhenshan97 root, score: 58.674 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906916912 | 8.81E-06 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906916912 | 3.94E-06 | NA | mr1155 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906916912 | NA | 9.70E-07 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906916912 | 5.71E-07 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |