\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906793623:

Variant ID: vg0906793623 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6793623
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTCTTTTCTTCATTGTTTTTAATATATTGATTTCACTCCATCCCCATCCCCAAAATCCCAAATCAATTATCACCTCCAAATCCTCAAATCGATCATCT[C/T]
CAAATACATCACAAAATCTTAAAAAAAATTACATCACAACATCTACAAAATTCATCACAAATAAATCACATATTCAATATCACAAATACATCTCGGATCC

Reverse complement sequence

GGATCCGAGATGTATTTGTGATATTGAATATGTGATTTATTTGTGATGAATTTTGTAGATGTTGTGATGTAATTTTTTTTAAGATTTTGTGATGTATTTG[G/A]
AGATGATCGATTTGAGGATTTGGAGGTGATAATTGATTTGGGATTTTGGGGATGGGGATGGAGTGAAATCAATATATTAAAAACAATGAAGAAAAGAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 0.30% 8.32% 0.68% NA
All Indica  2759 99.20% 0.00% 0.72% 0.04% NA
All Japonica  1512 77.80% 0.70% 20.97% 0.60% NA
Aus  269 87.40% 0.00% 4.83% 7.81% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 98.90% 0.10% 0.99% 0.00% NA
Indica Intermediate  786 98.90% 0.00% 1.02% 0.13% NA
Temperate Japonica  767 71.40% 0.80% 26.60% 1.17% NA
Tropical Japonica  504 89.10% 0.20% 10.71% 0.00% NA
Japonica Intermediate  241 74.30% 1.20% 24.48% 0.00% NA
VI/Aromatic  96 62.50% 1.00% 35.42% 1.04% NA
Intermediate  90 90.00% 0.00% 10.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906793623 C -> DEL N N silent_mutation Average:35.721; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg0906793623 C -> T LOC_Os09g12020-LOC_Os09g12050 intergenic_region ; MODIFIER silent_mutation Average:35.721; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906793623 NA 4.10E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906793623 NA 7.57E-06 mr1028 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906793623 3.50E-09 NA mr1648 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906793623 7.61E-06 1.24E-09 mr1648 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906793623 NA 6.58E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906793623 NA 3.80E-06 mr1652 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906793623 5.29E-06 2.59E-06 mr1697 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906793623 NA 1.32E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251