\
| Variant ID: vg0906793623 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6793623 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATTCTTTTCTTCATTGTTTTTAATATATTGATTTCACTCCATCCCCATCCCCAAAATCCCAAATCAATTATCACCTCCAAATCCTCAAATCGATCATCT[C/T]
CAAATACATCACAAAATCTTAAAAAAAATTACATCACAACATCTACAAAATTCATCACAAATAAATCACATATTCAATATCACAAATACATCTCGGATCC
GGATCCGAGATGTATTTGTGATATTGAATATGTGATTTATTTGTGATGAATTTTGTAGATGTTGTGATGTAATTTTTTTTAAGATTTTGTGATGTATTTG[G/A]
AGATGATCGATTTGAGGATTTGGAGGTGATAATTGATTTGGGATTTTGGGGATGGGGATGGAGTGAAATCAATATATTAAAAACAATGAAGAAAAGAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 0.30% | 8.32% | 0.68% | NA |
| All Indica | 2759 | 99.20% | 0.00% | 0.72% | 0.04% | NA |
| All Japonica | 1512 | 77.80% | 0.70% | 20.97% | 0.60% | NA |
| Aus | 269 | 87.40% | 0.00% | 4.83% | 7.81% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.90% | 0.10% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 0.00% | 1.02% | 0.13% | NA |
| Temperate Japonica | 767 | 71.40% | 0.80% | 26.60% | 1.17% | NA |
| Tropical Japonica | 504 | 89.10% | 0.20% | 10.71% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.30% | 1.20% | 24.48% | 0.00% | NA |
| VI/Aromatic | 96 | 62.50% | 1.00% | 35.42% | 1.04% | NA |
| Intermediate | 90 | 90.00% | 0.00% | 10.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906793623 | C -> DEL | N | N | silent_mutation | Average:35.721; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| vg0906793623 | C -> T | LOC_Os09g12020-LOC_Os09g12050 | intergenic_region ; MODIFIER | silent_mutation | Average:35.721; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906793623 | NA | 4.10E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906793623 | NA | 7.57E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906793623 | 3.50E-09 | NA | mr1648 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906793623 | 7.61E-06 | 1.24E-09 | mr1648 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906793623 | NA | 6.58E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906793623 | NA | 3.80E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906793623 | 5.29E-06 | 2.59E-06 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906793623 | NA | 1.32E-06 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |