\
| Variant ID: vg0906503067 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6503067 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.09, A: 0.01, others allele: 0.00, population size: 74. )
CTTATATAGGGGAAGGAGTCCGTATTACAAAATACAACACATATCCCTAACGGAATATGTGATTACAGATAAAATACAATCGTAACCGACTAGGATCCTG[G/T,A]
GTATTTCCTTGATATACGAGTTTAGAAACTAACCCGAATCCTCATAAAGGTATTCTATCTATATTTGGTACCCTGTACCCAACTAAACTATAACTGCCGT
ACGGCAGTTATAGTTTAGTTGGGTACAGGGTACCAAATATAGATAGAATACCTTTATGAGGATTCGGGTTAGTTTCTAAACTCGTATATCAAGGAAATAC[C/A,T]
CAGGATCCTAGTCGGTTACGATTGTATTTTATCTGTAATCACATATTCCGTTAGGGATATGTGTTGTATTTTGTAATACGGACTCCTTCCCCTATATAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.00% | 6.70% | 1.48% | 43.74% | A: 0.04% |
| All Indica | 2759 | 17.70% | 9.10% | 1.85% | 71.40% | A: 0.04% |
| All Japonica | 1512 | 95.20% | 3.00% | 0.13% | 1.65% | NA |
| Aus | 269 | 80.70% | 6.30% | 1.49% | 11.52% | NA |
| Indica I | 595 | 8.70% | 20.70% | 0.17% | 70.42% | NA |
| Indica II | 465 | 26.20% | 0.60% | 3.01% | 70.11% | NA |
| Indica III | 913 | 15.00% | 4.90% | 2.08% | 77.98% | NA |
| Indica Intermediate | 786 | 22.40% | 10.10% | 2.16% | 65.27% | A: 0.13% |
| Temperate Japonica | 767 | 98.20% | 1.30% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 97.40% | 1.80% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 80.90% | 11.20% | 0.41% | 7.47% | NA |
| VI/Aromatic | 96 | 72.90% | 0.00% | 9.38% | 16.67% | A: 1.04% |
| Intermediate | 90 | 61.10% | 6.70% | 4.44% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906503067 | G -> DEL | N | N | silent_mutation | Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0906503067 | G -> T | LOC_Os09g11640.1 | upstream_gene_variant ; 2405.0bp to feature; MODIFIER | silent_mutation | Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0906503067 | G -> T | LOC_Os09g11650.1 | upstream_gene_variant ; 360.0bp to feature; MODIFIER | silent_mutation | Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0906503067 | G -> T | LOC_Os09g11660.1 | downstream_gene_variant ; 148.0bp to feature; MODIFIER | silent_mutation | Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0906503067 | G -> T | LOC_Os09g11650-LOC_Os09g11660 | intergenic_region ; MODIFIER | silent_mutation | Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0906503067 | G -> A | LOC_Os09g11640.1 | upstream_gene_variant ; 2405.0bp to feature; MODIFIER | silent_mutation | Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0906503067 | G -> A | LOC_Os09g11650.1 | upstream_gene_variant ; 360.0bp to feature; MODIFIER | silent_mutation | Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0906503067 | G -> A | LOC_Os09g11660.1 | downstream_gene_variant ; 148.0bp to feature; MODIFIER | silent_mutation | Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0906503067 | G -> A | LOC_Os09g11650-LOC_Os09g11660 | intergenic_region ; MODIFIER | silent_mutation | Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906503067 | 2.69E-06 | 2.69E-06 | mr1312_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906503067 | NA | 1.21E-06 | mr1417_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906503067 | NA | 5.44E-06 | mr1683_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906503067 | 5.76E-06 | 5.76E-06 | mr1812_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906503067 | 4.17E-06 | 4.17E-06 | mr1833_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |