\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906503067:

Variant ID: vg0906503067 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6503067
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, T: 0.09, A: 0.01, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


CTTATATAGGGGAAGGAGTCCGTATTACAAAATACAACACATATCCCTAACGGAATATGTGATTACAGATAAAATACAATCGTAACCGACTAGGATCCTG[G/T,A]
GTATTTCCTTGATATACGAGTTTAGAAACTAACCCGAATCCTCATAAAGGTATTCTATCTATATTTGGTACCCTGTACCCAACTAAACTATAACTGCCGT

Reverse complement sequence

ACGGCAGTTATAGTTTAGTTGGGTACAGGGTACCAAATATAGATAGAATACCTTTATGAGGATTCGGGTTAGTTTCTAAACTCGTATATCAAGGAAATAC[C/A,T]
CAGGATCCTAGTCGGTTACGATTGTATTTTATCTGTAATCACATATTCCGTTAGGGATATGTGTTGTATTTTGTAATACGGACTCCTTCCCCTATATAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.00% 6.70% 1.48% 43.74% A: 0.04%
All Indica  2759 17.70% 9.10% 1.85% 71.40% A: 0.04%
All Japonica  1512 95.20% 3.00% 0.13% 1.65% NA
Aus  269 80.70% 6.30% 1.49% 11.52% NA
Indica I  595 8.70% 20.70% 0.17% 70.42% NA
Indica II  465 26.20% 0.60% 3.01% 70.11% NA
Indica III  913 15.00% 4.90% 2.08% 77.98% NA
Indica Intermediate  786 22.40% 10.10% 2.16% 65.27% A: 0.13%
Temperate Japonica  767 98.20% 1.30% 0.13% 0.39% NA
Tropical Japonica  504 97.40% 1.80% 0.00% 0.79% NA
Japonica Intermediate  241 80.90% 11.20% 0.41% 7.47% NA
VI/Aromatic  96 72.90% 0.00% 9.38% 16.67% A: 1.04%
Intermediate  90 61.10% 6.70% 4.44% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906503067 G -> DEL N N silent_mutation Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0906503067 G -> T LOC_Os09g11640.1 upstream_gene_variant ; 2405.0bp to feature; MODIFIER silent_mutation Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0906503067 G -> T LOC_Os09g11650.1 upstream_gene_variant ; 360.0bp to feature; MODIFIER silent_mutation Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0906503067 G -> T LOC_Os09g11660.1 downstream_gene_variant ; 148.0bp to feature; MODIFIER silent_mutation Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0906503067 G -> T LOC_Os09g11650-LOC_Os09g11660 intergenic_region ; MODIFIER silent_mutation Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0906503067 G -> A LOC_Os09g11640.1 upstream_gene_variant ; 2405.0bp to feature; MODIFIER silent_mutation Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0906503067 G -> A LOC_Os09g11650.1 upstream_gene_variant ; 360.0bp to feature; MODIFIER silent_mutation Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0906503067 G -> A LOC_Os09g11660.1 downstream_gene_variant ; 148.0bp to feature; MODIFIER silent_mutation Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0906503067 G -> A LOC_Os09g11650-LOC_Os09g11660 intergenic_region ; MODIFIER silent_mutation Average:33.389; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906503067 2.69E-06 2.69E-06 mr1312_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906503067 NA 1.21E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906503067 NA 5.44E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906503067 5.76E-06 5.76E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906503067 4.17E-06 4.17E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251