Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0906443883:

Variant ID: vg0906443883 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6443883
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAAAATGAGTGGAGTGGGTGGCACAGTGAAGTAGTAGTAGTACAAGTACTTGTGTGATTTTTTTTTACCGTGCACTGCAGCTCCCACATGAGAGTTGGT[A/G]
GCACAGTAGAGTTTGCACTATTAATAAAGTATGCAATTCAAACATGATCTGAAAAACATGCATGTTTTGTTTTGAGTTGTATCTTGCCTCCGTTTATGGA

Reverse complement sequence

TCCATAAACGGAGGCAAGATACAACTCAAAACAAAACATGCATGTTTTTCAGATCATGTTTGAATTGCATACTTTATTAATAGTGCAAACTCTACTGTGC[T/C]
ACCAACTCTCATGTGGGAGCTGCAGTGCACGGTAAAAAAAAATCACACAAGTACTTGTACTACTACTACTTCACTGTGCCACCCACTCCACTCATTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.90%	21.80%	0.34%	0.00%	NA
All Indica	2759	68.60%	30.80%	0.54%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	59.10%	40.90%	0.00%	0.00%	NA
Indica I	595	96.10%	3.90%	0.00%	0.00%	NA
Indica II	465	46.00%	53.10%	0.86%	0.00%	NA
Indica III	913	64.70%	34.70%	0.55%	0.00%	NA
Indica Intermediate	786	65.80%	33.50%	0.76%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	55.20%	43.80%	1.04%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906443883	A -> G	LOC_Os09g11510.1	upstream_gene_variant ; 4958.0bp to feature; MODIFIER	silent_mutation	Average:51.16; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg0906443883	A -> G	LOC_Os09g11520.1	upstream_gene_variant ; 1978.0bp to feature; MODIFIER	silent_mutation	Average:51.16; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg0906443883	A -> G	LOC_Os09g11530.1	upstream_gene_variant ; 214.0bp to feature; MODIFIER	silent_mutation	Average:51.16; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg0906443883	A -> G	LOC_Os09g11550.1	upstream_gene_variant ; 2168.0bp to feature; MODIFIER	silent_mutation	Average:51.16; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg0906443883	A -> G	LOC_Os09g11540.1	downstream_gene_variant ; 977.0bp to feature; MODIFIER	silent_mutation	Average:51.16; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg0906443883	A -> G	LOC_Os09g11530-LOC_Os09g11540	intergenic_region ; MODIFIER	silent_mutation	Average:51.16; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906443883	NA	3.31E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906443883	2.41E-07	2.41E-07	mr1947_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906443883	8.76E-07	5.22E-08	mr1951_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906443883	4.65E-06	8.40E-07	mr1951_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251