\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906303350:

Variant ID: vg0906303350 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6303350
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, C: 0.20, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCGGAAGCGTAATTAATTAATTTATTACATGGGCGGCGAAGACCCAATACACAAGAAGACAAACGAAAAACAGCGGAAGACTAGGGTGTCGACCACAT[C/G]
CGCTTGACGGCAGGCACGAGCCAGACACCAAAGCCTTCATCATCCAGGGGCTCCTCTTCTGGGTTTGGCAAAAATTGAGAAAGACTGAGTACAACCACCG

Reverse complement sequence

CGGTGGTTGTACTCAGTCTTTCTCAATTTTTGCCAAACCCAGAAGAGGAGCCCCTGGATGATGAAGGCTTTGGTGTCTGGCTCGTGCCTGCCGTCAAGCG[G/C]
ATGTGGTCGACACCCTAGTCTTCCGCTGTTTTTCGTTTGTCTTCTTGTGTATTGGGTCTTCGCCGCCCATGTAATAAATTAATTAATTACGCTTCCGCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.90% 9.30% 1.88% 55.86% NA
All Indica  2759 9.70% 7.00% 2.25% 81.04% NA
All Japonica  1512 81.60% 14.40% 0.00% 3.97% NA
Aus  269 2.20% 6.30% 8.55% 82.90% NA
Indica I  595 15.80% 9.20% 1.01% 73.95% NA
Indica II  465 9.00% 0.20% 5.59% 85.16% NA
Indica III  913 7.40% 5.70% 1.97% 84.88% NA
Indica Intermediate  786 8.00% 10.90% 1.53% 79.52% NA
Temperate Japonica  767 92.60% 6.00% 0.00% 1.43% NA
Tropical Japonica  504 82.70% 15.50% 0.00% 1.79% NA
Japonica Intermediate  241 44.40% 39.00% 0.00% 16.60% NA
VI/Aromatic  96 8.30% 3.10% 0.00% 88.54% NA
Intermediate  90 46.70% 8.90% 4.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906303350 C -> G LOC_Os09g11350.1 downstream_gene_variant ; 1155.0bp to feature; MODIFIER silent_mutation Average:36.812; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0906303350 C -> G LOC_Os09g11360.1 downstream_gene_variant ; 2258.0bp to feature; MODIFIER silent_mutation Average:36.812; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0906303350 C -> G LOC_Os09g11350-LOC_Os09g11360 intergenic_region ; MODIFIER silent_mutation Average:36.812; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0906303350 C -> DEL N N silent_mutation Average:36.812; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906303350 NA 6.64E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906303350 NA 4.84E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906303350 5.65E-06 1.87E-08 mr1842_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251