\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906170235:

Variant ID: vg0906170235 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6170235
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


GCACCCTAGGACCCTCATCTGGTCCTCTACGTCGACTTTTCTTTGGGCTTCCAACATGTTTGTCAAACTTTGGTGGATCAATATCATATCAGGTGAATCT[A/G]
TTTTTGTCCAGCTATGCTCATCAGGGACTAGATAGATAACTGCAGTATATGTTCTCATATAAGCATCCTTCCTAAAATAATCAGCGACATAATCTTCGGG

Reverse complement sequence

CCCGAAGATTATGTCGCTGATTATTTTAGGAAGGATGCTTATATGAGAACATATACTGCAGTTATCTATCTAGTCCCTGATGAGCATAGCTGGACAAAAA[T/C]
AGATTCACCTGATATGATATTGATCCACCAAAGTTTGACAAACATGTTGGAAGCCCAAAGAAAAGTCGACGTAGAGGACCAGATGAGGGTCCTAGGGTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 2.50% 14.79% 11.32% NA
All Indica  2759 56.40% 3.90% 20.80% 18.96% NA
All Japonica  1512 99.50% 0.20% 0.00% 0.26% NA
Aus  269 52.00% 3.30% 43.87% 0.74% NA
Indica I  595 41.20% 2.70% 28.07% 28.07% NA
Indica II  465 77.40% 0.90% 7.96% 13.76% NA
Indica III  913 50.70% 6.90% 24.75% 17.63% NA
Indica Intermediate  786 62.00% 3.10% 18.32% 16.67% NA
Temperate Japonica  767 99.50% 0.40% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 0.00% 2.08% 1.04% NA
Intermediate  90 88.90% 0.00% 5.56% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906170235 A -> G LOC_Os09g11120.1 upstream_gene_variant ; 3973.0bp to feature; MODIFIER silent_mutation Average:44.511; most accessible tissue: Callus, score: 70.526 N N N N
vg0906170235 A -> G LOC_Os09g11130.1 downstream_gene_variant ; 1379.0bp to feature; MODIFIER silent_mutation Average:44.511; most accessible tissue: Callus, score: 70.526 N N N N
vg0906170235 A -> G LOC_Os09g11140.1 downstream_gene_variant ; 884.0bp to feature; MODIFIER silent_mutation Average:44.511; most accessible tissue: Callus, score: 70.526 N N N N
vg0906170235 A -> G LOC_Os09g11130-LOC_Os09g11140 intergenic_region ; MODIFIER silent_mutation Average:44.511; most accessible tissue: Callus, score: 70.526 N N N N
vg0906170235 A -> DEL N N silent_mutation Average:44.511; most accessible tissue: Callus, score: 70.526 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906170235 3.24E-06 NA mr1231 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906170235 2.57E-07 1.37E-07 mr1231 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906170235 NA 9.07E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906170235 5.32E-06 4.37E-07 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251