Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0906169562:

Variant ID: vg0906169562 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6169562
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATTCATGGCTAAAGCTATATAACTGCAAGTCCACAAAAGTGTACTGCATTACATATGTTGAGCAAAATAGAAGGAGCAAACCCGCATGAAGCACTCAAT[C/T]
CTATTTTAACAATTTAAGGTTGACAATACAATATAGCAGAGTACTATTACAATATATTAGAAGTCTATAGTTATATAACTACTAGGATTTTAGTTTATCA

Reverse complement sequence

TGATAAACTAAAATCCTAGTAGTTATATAACTATAGACTTCTAATATATTGTAATAGTACTCTGCTATATTGTATTGTCAACCTTAAATTGTTAAAATAG[G/A]
ATTGAGTGCTTCATGCGGGTTTGCTCCTTCTATTTTGCTCAACATATGTAATGCAGTACACTTTTGTGGACTTGCAGTTATATAGCTTTAGCCATGAATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.90%	4.80%	13.80%	9.52%	NA
All Indica	2759	61.10%	2.50%	20.59%	15.80%	NA
All Japonica	1512	99.70%	0.10%	0.20%	0.07%	NA
Aus	269	31.60%	38.30%	27.88%	2.23%	NA
Indica I	595	52.40%	0.20%	28.24%	19.16%	NA
Indica II	465	80.00%	1.10%	12.69%	6.24%	NA
Indica III	913	52.60%	3.40%	22.67%	21.36%	NA
Indica Intermediate	786	66.50%	3.90%	17.05%	12.47%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.40%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	53.10%	43.80%	1.04%	2.08%	NA
Intermediate	90	75.60%	13.30%	5.56%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906169562	C -> DEL	N	N	silent_mutation	Average:31.188; most accessible tissue: Callus, score: 59.262	N	N	N	N
vg0906169562	C -> T	LOC_Os09g11120.1	upstream_gene_variant ; 3300.0bp to feature; MODIFIER	silent_mutation	Average:31.188; most accessible tissue: Callus, score: 59.262	N	N	N	N
vg0906169562	C -> T	LOC_Os09g11130.1	downstream_gene_variant ; 706.0bp to feature; MODIFIER	silent_mutation	Average:31.188; most accessible tissue: Callus, score: 59.262	N	N	N	N
vg0906169562	C -> T	LOC_Os09g11140.1	downstream_gene_variant ; 1557.0bp to feature; MODIFIER	silent_mutation	Average:31.188; most accessible tissue: Callus, score: 59.262	N	N	N	N
vg0906169562	C -> T	LOC_Os09g11130-LOC_Os09g11140	intergenic_region ; MODIFIER	silent_mutation	Average:31.188; most accessible tissue: Callus, score: 59.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906169562	NA	3.80E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906169562	3.75E-06	7.22E-06	mr1511	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906169562	NA	4.47E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906169562	NA	7.16E-06	mr1684	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906169562	NA	2.65E-08	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906169562	NA	7.58E-07	mr1734	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251