\
| Variant ID: vg0905859096 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5859096 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 254. )
AGACGAATTTATTAAACCTAATTAATCTGTCATTAGCAAATGTTTACTGTAGCACCACATTATCAAATCATGGAGTAAATAAGGTTAAAAGATTCGTCTC[G/A]
CAATTTACACGCAATCTGTGCAATTAGTTTTTTGTTTTTTCTATATTTAATACTCCATACATATGTTCAAACATTCGATGTGACAGGATAAAAAGTTTTT
AAAAACTTTTTATCCTGTCACATCGAATGTTTGAACATATGTATGGAGTATTAAATATAGAAAAAACAAAAAACTAATTGCACAGATTGCGTGTAAATTG[C/T]
GAGACGAATCTTTTAACCTTATTTACTCCATGATTTGATAATGTGGTGCTACAGTAAACATTTGCTAATGACAGATTAATTAGGTTTAATAAATTCGTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 48.00% | 52.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905859096 | G -> A | LOC_Os09g10730.1 | upstream_gene_variant ; 1945.0bp to feature; MODIFIER | silent_mutation | Average:44.246; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0905859096 | G -> A | LOC_Os09g10740.1 | upstream_gene_variant ; 4845.0bp to feature; MODIFIER | silent_mutation | Average:44.246; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0905859096 | G -> A | LOC_Os09g10730-LOC_Os09g10740 | intergenic_region ; MODIFIER | silent_mutation | Average:44.246; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905859096 | 1.11E-06 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 5.80E-06 | NA | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 1.42E-07 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 9.23E-06 | NA | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 2.69E-07 | 8.64E-18 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 2.82E-08 | 5.50E-17 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 4.35E-07 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 1.44E-08 | NA | mr1118_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 2.11E-07 | 6.90E-18 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 2.76E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 4.66E-07 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 9.10E-09 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 3.07E-09 | NA | mr1242_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 2.79E-06 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | 9.54E-07 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905859096 | NA | 6.44E-16 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |