\
| Variant ID: vg0905711051 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5711051 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AATATGCCGATTCGTGAGCTTCCTTTAGGATTAATCCTCTCAGTCCACCCTGTTCGGGTACATAGATCCTCTTTTTATACCAAAGGACATCTTTTTCATC[G/T]
GTCAAAAATTCCTTTGCAAACCCTGCAGCTAGGCGTTCCTTCACCTCTTGGATTTCTTCGTTGTCCTTCTGGGCTTCTTCTATTTGGGTTCTCAAAAGAG
CTCTTTTGAGAACCCAAATAGAAGAAGCCCAGAAGGACAACGAAGAAATCCAAGAGGTGAAGGAACGCCTAGCTGCAGGGTTTGCAAAGGAATTTTTGAC[C/A]
GATGAAAAAGATGTCCTTTGGTATAAAAAGAGGATCTATGTACCCGAACAGGGTGGACTGAGAGGATTAATCCTAAAGGAAGCTCACGAATCGGCATATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 32.50% | 1.04% | 6.16% | NA |
| All Indica | 2759 | 91.10% | 8.20% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 1.90% | 81.40% | 0.26% | 16.47% | NA |
| Aus | 269 | 87.40% | 11.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 80.70% | 17.60% | 1.68% | 0.00% | NA |
| Indica II | 465 | 90.10% | 9.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 97.00% | 2.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.70% | 6.60% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 90.70% | 0.39% | 7.56% | NA |
| Tropical Japonica | 504 | 1.40% | 82.10% | 0.00% | 16.47% | NA |
| Japonica Intermediate | 241 | 4.60% | 50.20% | 0.41% | 44.81% | NA |
| VI/Aromatic | 96 | 31.20% | 3.10% | 25.00% | 40.62% | NA |
| Intermediate | 90 | 46.70% | 48.90% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905711051 | G -> DEL | LOC_Os09g10450.1 | N | frameshift_variant | Average:27.524; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0905711051 | G -> T | LOC_Os09g10450.1 | synonymous_variant ; p.Thr502Thr; LOW | synonymous_codon | Average:27.524; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905711051 | NA | 2.57E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | NA | 4.14E-10 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | 7.94E-06 | NA | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | 7.57E-06 | 2.10E-11 | mr1637 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | NA | 4.96E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | NA | 1.44E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | NA | 7.67E-11 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | 2.78E-06 | NA | mr1937 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | NA | 1.78E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | NA | 3.47E-14 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | NA | 5.57E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905711051 | NA | 3.33E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |