\
| Variant ID: vg0905314628 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 5314628 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 222. )
AGTGCTTCCGATCCAGTCGGCCAGTCAGATGCTCGCAAGAGGAAGCTGGTTCTAAGCGACGAGGAAGGCGATGATACCGGAAGGCTCGGAGAAAAAGGAG[C/T]
GACCGGAAAATCCCCAAAGCCAACTAATCCGAAGAAGAAAACCTCCAGTCGTCCTTTGCCAAAAATCAGAAAGTCTTCCAGGTACAAACCATTTGGCCAT
ATGGCCAAATGGTTTGTACCTGGAAGACTTTCTGATTTTTGGCAAAGGACGACTGGAGGTTTTCTTCTTCGGATTAGTTGGCTTTGGGGATTTTCCGGTC[G/A]
CTCCTTTTTCTCCGAGCCTTCCGGTATCATCGCCTTCCTCGTCGCTTAGAACCAGCTTCCTCTTGCGAGCATCTGACTGGCCGACTGGATCGGAAGCACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.60% | 13.80% | 16.63% | 0.00% | NA |
| All Indica | 2759 | 50.30% | 22.70% | 27.00% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.30% | 0.53% | 0.00% | NA |
| Aus | 269 | 89.60% | 4.10% | 6.32% | 0.00% | NA |
| Indica I | 595 | 51.80% | 9.20% | 38.99% | 0.00% | NA |
| Indica II | 465 | 31.40% | 28.40% | 40.22% | 0.00% | NA |
| Indica III | 913 | 56.50% | 32.10% | 11.39% | 0.00% | NA |
| Indica Intermediate | 786 | 53.10% | 18.70% | 28.24% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.00% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.60% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 11.10% | 16.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0905314628 | C -> T | LOC_Os09g09800.1 | missense_variant ; p.Ala365Val; MODERATE | nonsynonymous_codon ; A365V | Average:17.759; most accessible tissue: Minghui63 panicle, score: 20.733 | unknown | unknown | TOLERATED | 0.71 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0905314628 | NA | 1.30E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | NA | 8.61E-07 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | NA | 1.71E-08 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | NA | 7.19E-06 | mr1622 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | NA | 4.17E-08 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | NA | 1.78E-09 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | NA | 4.48E-06 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | NA | 1.57E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | NA | 5.18E-16 | mr1830_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | NA | 1.04E-11 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | 6.99E-07 | 5.70E-22 | mr1846_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0905314628 | 5.13E-06 | 2.45E-22 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |