\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905314628:

Variant ID: vg0905314628 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5314628
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGCTTCCGATCCAGTCGGCCAGTCAGATGCTCGCAAGAGGAAGCTGGTTCTAAGCGACGAGGAAGGCGATGATACCGGAAGGCTCGGAGAAAAAGGAG[C/T]
GACCGGAAAATCCCCAAAGCCAACTAATCCGAAGAAGAAAACCTCCAGTCGTCCTTTGCCAAAAATCAGAAAGTCTTCCAGGTACAAACCATTTGGCCAT

Reverse complement sequence

ATGGCCAAATGGTTTGTACCTGGAAGACTTTCTGATTTTTGGCAAAGGACGACTGGAGGTTTTCTTCTTCGGATTAGTTGGCTTTGGGGATTTTCCGGTC[G/A]
CTCCTTTTTCTCCGAGCCTTCCGGTATCATCGCCTTCCTCGTCGCTTAGAACCAGCTTCCTCTTGCGAGCATCTGACTGGCCGACTGGATCGGAAGCACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 13.80% 16.63% 0.00% NA
All Indica  2759 50.30% 22.70% 27.00% 0.00% NA
All Japonica  1512 99.20% 0.30% 0.53% 0.00% NA
Aus  269 89.60% 4.10% 6.32% 0.00% NA
Indica I  595 51.80% 9.20% 38.99% 0.00% NA
Indica II  465 31.40% 28.40% 40.22% 0.00% NA
Indica III  913 56.50% 32.10% 11.39% 0.00% NA
Indica Intermediate  786 53.10% 18.70% 28.24% 0.00% NA
Temperate Japonica  767 99.50% 0.00% 0.52% 0.00% NA
Tropical Japonica  504 98.80% 0.60% 0.60% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 72.20% 11.10% 16.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905314628 C -> T LOC_Os09g09800.1 missense_variant ; p.Ala365Val; MODERATE nonsynonymous_codon ; A365V Average:17.759; most accessible tissue: Minghui63 panicle, score: 20.733 unknown unknown TOLERATED 0.71

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905314628 NA 1.30E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 NA 8.61E-07 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 NA 1.71E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 NA 7.19E-06 mr1622 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 NA 4.17E-08 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 NA 1.78E-09 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 NA 4.48E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 NA 1.57E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 NA 5.18E-16 mr1830_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 NA 1.04E-11 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 6.99E-07 5.70E-22 mr1846_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905314628 5.13E-06 2.45E-22 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251