\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0905150688:

Variant ID: vg0905150688 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 5150688
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCCCTTCATTGATTGGCTGATATGAACTTGGTTGATGATTATTGATGTGATCTTGACTACTTGGCTCATGTGATCTTTGAGCTTGGTTTTCTGGCTCA[T/C]
GCGACCTTTTAGCCTATAGAAAAAAACAAACATTACAACATTGCAAAATGGAGTAATATTGAACTAAATCATAAAAGGAGAAATTTAGTATTGCCTTGAG

Reverse complement sequence

CTCAAGGCAATACTAAATTTCTCCTTTTATGATTTAGTTCAATATTACTCCATTTTGCAATGTTGTAATGTTTGTTTTTTTCTATAGGCTAAAAGGTCGC[A/G]
TGAGCCAGAAAACCAAGCTCAAAGATCACATGAGCCAAGTAGTCAAGATCACATCAATAATCATCAACCAAGTTCATATCAGCCAATCAATGAAGGGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 42.90% 0.06% 0.72% NA
All Indica  2759 90.80% 7.90% 0.07% 1.23% NA
All Japonica  1512 1.90% 98.10% 0.00% 0.00% NA
Aus  269 19.30% 80.70% 0.00% 0.00% NA
Indica I  595 94.80% 5.20% 0.00% 0.00% NA
Indica II  465 85.60% 7.70% 0.00% 6.67% NA
Indica III  913 95.20% 4.80% 0.00% 0.00% NA
Indica Intermediate  786 85.90% 13.50% 0.25% 0.38% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 6.60% 93.40% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0905150688 T -> DEL N N silent_mutation Average:46.695; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg0905150688 T -> C LOC_Os09g09540.1 3_prime_UTR_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:46.695; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0905150688 NA 8.32E-25 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 5.46E-14 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 3.44E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 2.01E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 1.38E-24 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 1.34E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 2.64E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 3.39E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 3.97E-34 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 1.05E-30 mr1051_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 8.10E-37 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 2.02E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 3.93E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 3.26E-10 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0905150688 NA 2.13E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251