\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904578294:

Variant ID: vg0904578294 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4578294
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TATCAGGTTTTTTTCCAGTCACTAACTCCCCATTGTTGTTTACTGCACATCTATAAGGTATGCCTTTTCCTTTGTTGGTGTCCAGGTTCCCACAACTGCA[C/T]
ATGCATGATGCGCAGATCAAACTGAACGGAATGGAATGACGTTGCAATGTGCATAGGTGAGCGGTGAGCCTGCTGCTCAATCTGTAGTTTAGAAGAAGCA

Reverse complement sequence

TGCTTCTTCTAAACTACAGATTGAGCAGCAGGCTCACCGCTCACCTATGCACATTGCAACGTCATTCCATTCCGTTCAGTTTGATCTGCGCATCATGCAT[G/A]
TGCAGTTGTGGGAACCTGGACACCAACAAAGGAAAAGGCATACCTTATAGATGTGCAGTAAACAACAATGGGGAGTTAGTGACTGGAAAAAAACCTGATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.50% 39.40% 0.55% 11.51% NA
All Indica  2759 80.80% 16.40% 0.29% 2.50% NA
All Japonica  1512 1.40% 67.50% 1.06% 30.03% NA
Aus  269 0.00% 99.60% 0.00% 0.37% NA
Indica I  595 68.90% 24.50% 0.67% 5.88% NA
Indica II  465 84.30% 15.10% 0.22% 0.43% NA
Indica III  913 88.90% 9.20% 0.11% 1.75% NA
Indica Intermediate  786 78.40% 19.30% 0.25% 2.04% NA
Temperate Japonica  767 0.50% 98.00% 0.00% 1.43% NA
Tropical Japonica  504 2.00% 21.00% 2.78% 74.21% NA
Japonica Intermediate  241 2.90% 67.60% 0.83% 28.63% NA
VI/Aromatic  96 3.10% 90.60% 0.00% 6.25% NA
Intermediate  90 44.40% 37.80% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904578294 C -> DEL LOC_Os09g08710.2 N frameshift_variant Average:67.326; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0904578294 C -> DEL LOC_Os09g08710.3 N frameshift_variant Average:67.326; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0904578294 C -> T LOC_Os09g08710.3 synonymous_variant ; p.His48His; LOW synonymous_codon Average:67.326; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0904578294 C -> T LOC_Os09g08710.2 synonymous_variant ; p.His48His; LOW synonymous_codon Average:67.326; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904578294 NA 3.10E-06 mr1201 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 5.77E-07 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 1.36E-06 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 1.21E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 2.63E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 5.10E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 6.10E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 3.67E-10 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 2.29E-14 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 3.55E-06 mr1189_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 5.57E-07 mr1471_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 2.70E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 2.19E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 1.63E-06 mr1722_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 1.97E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 5.76E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 9.25E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 7.05E-11 mr1782_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 4.18E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904578294 NA 2.73E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251