Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0904232954:

Variant ID: vg0904232954 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 4232954
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

GAAACGAGGAGGCGAGCGCAGGCGAGGTGAGGATAAAAGGATACGGAGGCAGGGACTTTGCATTCTTCCTTTCGCCAAGTGCTCACCCGCCTACTCACCC[G/A]
CCTACTCGCTCTCTAAGCCCTAACATTCTCGCCAATTCACACTACTCCGCGCGCCAAGCCCTTCGCCGTTTCTCCGCCGGCCATCATGGCTCAAGACGCT

Reverse complement sequence

AGCGTCTTGAGCCATGATGGCCGGCGGAGAAACGGCGAAGGGCTTGGCGCGCGGAGTAGTGTGAATTGGCGAGAATGTTAGGGCTTAGAGAGCGAGTAGG[C/T]
GGGTGAGTAGGCGGGTGAGCACTTGGCGAAAGGAAGAATGCAAAGTCCCTGCCTCCGTATCCTTTTATCCTCACCTCGCCTGCGCTCGCCTCCTCGTTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.40%	4.20%	1.48%	18.90%	NA
All Indica	2759	68.40%	7.00%	2.36%	22.22%	NA
All Japonica	1512	85.10%	0.00%	0.20%	14.75%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	88.40%	1.00%	1.18%	9.41%	NA
Indica II	465	73.30%	12.30%	1.51%	12.90%	NA
Indica III	913	49.70%	5.30%	4.05%	40.96%	NA
Indica Intermediate	786	72.00%	10.60%	1.78%	15.65%	NA
Temperate Japonica	767	81.10%	0.00%	0.26%	18.64%	NA
Tropical Japonica	504	96.80%	0.00%	0.00%	3.17%	NA
Japonica Intermediate	241	73.00%	0.00%	0.41%	26.56%	NA
VI/Aromatic	96	54.20%	0.00%	1.04%	44.79%	NA
Intermediate	90	80.00%	4.40%	1.11%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0904232954	G -> DEL	N	N	silent_mutation	Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0904232954	G -> A	LOC_Os09g08170.1	upstream_gene_variant ; 86.0bp to feature; MODIFIER	silent_mutation	Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0904232954	G -> A	LOC_Os09g08160.1	downstream_gene_variant ; 3176.0bp to feature; MODIFIER	silent_mutation	Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0904232954	G -> A	LOC_Os09g08180.1	downstream_gene_variant ; 2989.0bp to feature; MODIFIER	silent_mutation	Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N
vg0904232954	G -> A	LOC_Os09g08160-LOC_Os09g08170	intergenic_region ; MODIFIER	silent_mutation	Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0904232954	NA	8.06E-07	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954	NA	4.63E-06	mr1497_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954	NA	7.45E-07	mr1508_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954	NA	7.68E-08	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954	NA	2.92E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954	NA	2.14E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954	NA	2.14E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954	NA	1.15E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251