\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0904232954:

Variant ID: vg0904232954 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 4232954
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


GAAACGAGGAGGCGAGCGCAGGCGAGGTGAGGATAAAAGGATACGGAGGCAGGGACTTTGCATTCTTCCTTTCGCCAAGTGCTCACCCGCCTACTCACCC[G/A]
CCTACTCGCTCTCTAAGCCCTAACATTCTCGCCAATTCACACTACTCCGCGCGCCAAGCCCTTCGCCGTTTCTCCGCCGGCCATCATGGCTCAAGACGCT

Reverse complement sequence

AGCGTCTTGAGCCATGATGGCCGGCGGAGAAACGGCGAAGGGCTTGGCGCGCGGAGTAGTGTGAATTGGCGAGAATGTTAGGGCTTAGAGAGCGAGTAGG[C/T]
GGGTGAGTAGGCGGGTGAGCACTTGGCGAAAGGAAGAATGCAAAGTCCCTGCCTCCGTATCCTTTTATCCTCACCTCGCCTGCGCTCGCCTCCTCGTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 4.20% 1.48% 18.90% NA
All Indica  2759 68.40% 7.00% 2.36% 22.22% NA
All Japonica  1512 85.10% 0.00% 0.20% 14.75% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 88.40% 1.00% 1.18% 9.41% NA
Indica II  465 73.30% 12.30% 1.51% 12.90% NA
Indica III  913 49.70% 5.30% 4.05% 40.96% NA
Indica Intermediate  786 72.00% 10.60% 1.78% 15.65% NA
Temperate Japonica  767 81.10% 0.00% 0.26% 18.64% NA
Tropical Japonica  504 96.80% 0.00% 0.00% 3.17% NA
Japonica Intermediate  241 73.00% 0.00% 0.41% 26.56% NA
VI/Aromatic  96 54.20% 0.00% 1.04% 44.79% NA
Intermediate  90 80.00% 4.40% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0904232954 G -> DEL N N silent_mutation Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0904232954 G -> A LOC_Os09g08170.1 upstream_gene_variant ; 86.0bp to feature; MODIFIER silent_mutation Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0904232954 G -> A LOC_Os09g08160.1 downstream_gene_variant ; 3176.0bp to feature; MODIFIER silent_mutation Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0904232954 G -> A LOC_Os09g08180.1 downstream_gene_variant ; 2989.0bp to feature; MODIFIER silent_mutation Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0904232954 G -> A LOC_Os09g08160-LOC_Os09g08170 intergenic_region ; MODIFIER silent_mutation Average:57.862; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0904232954 NA 8.06E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954 NA 4.63E-06 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954 NA 7.45E-07 mr1508_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954 NA 7.68E-08 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954 NA 2.92E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954 NA 2.14E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954 NA 2.14E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0904232954 NA 1.15E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251