Search for Variation information by Variation ID:
Detailed information for vg0904149706:
| Variant ID: vg0904149706 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 4149706 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TTTTTCGAACTCAAGGTCACGCCTCCGATTGTCAGCGTAAATCTTCTGACGGTTCTGCGCTGTCTTTAAACGTTCTCGGATCAGCTTAACTTGTTCTTCT[G/A]
CTGCCTTGAGCATGTCAGGACCGAATACCAGCGCTTCGCCCACCTCATTCCAGCACAAGGGAGTGCAACACTTTCTTCCGAACATTGCCTCATTCGGCGA
Reverse complement sequence
TCGCCGAATGAGGCAATGTTCGGAAGAAAGTGTTGCACTCCCTTGTGCTGGAATGAGGTGGGCGAAGCGCTGGTATTCGGTCCTGACATGCTCAAGGCAG[C/T]
AGAAGAACAAGTTAAGCTGATCCGAGAACGTTTAAAGACAGCGCAGAACCGTCAGAAGATTTACGCTGACAATCGGAGGCGTGACCTTGAGTTCGAAAAA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.00% | 4.60% | 4.04% | 14.35% | NA |
| All Indica | 2759 | 62.70% | 7.80% | 5.94% | 23.49% | NA |
| All Japonica | 1512 | 97.50% | 0.00% | 1.52% | 0.99% | NA |
| Aus | 269 | 98.50% | 0.00% | 0.37% | 1.12% | NA |
| Indica I | 595 | 49.40% | 3.00% | 6.39% | 41.18% | NA |
| Indica II | 465 | 71.60% | 0.90% | 4.30% | 23.23% | NA |
| Indica III | 913 | 67.60% | 13.40% | 5.15% | 13.91% | NA |
| Indica Intermediate | 786 | 62.00% | 9.20% | 7.51% | 21.37% | NA |
| Temperate Japonica | 767 | 95.60% | 0.00% | 2.74% | 1.69% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 1.10% | 1.11% | 13.33% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0904149706 | G -> DEL | LOC_Os09g08040.1 | N | frameshift_variant | Average:30.149; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | N | N | N | N |
| vg0904149706 | G -> A | LOC_Os09g08040.1 | missense_variant ; p.Ala755Val; MODERATE | nonsynonymous_codon ; A755V | Average:30.149; most accessible tissue: Zhenshan97 flag leaf, score: 77.738 | benign  |
0.593 |
DELETERIOUS | 0.02 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0904149706 | 9.76E-06 | 1.91E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904149706 | NA | 3.65E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904149706 | NA | 2.28E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904149706 | NA | 2.41E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904149706 | 8.21E-07 | 8.20E-07 | mr1822_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904149706 | 4.62E-06 | 4.62E-06 | mr1822_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0904149706 | 6.72E-06 | NA | mr1950_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |