\
| Variant ID: vg0901967595 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1967595 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 115. )
CCAGGAAAATTTCAGAGAGTATAATTAACCATGGAGAAGTTAATGAAAATTAAATCCAGCCATGCTTTATATTTAGGAAATTTTATTTCCCACATTTAAC[A/T]
TCACTTGTAAATTAATGAACATTTAATATAAATTCTAATAATAATTTATTAAATAATTTATAAATCATAAGAAGAAAATCAAGATGTGACAATTTCATCC
GGATGAAATTGTCACATCTTGATTTTCTTCTTATGATTTATAAATTATTTAATAAATTATTATTAGAATTTATATTAAATGTTCATTAATTTACAAGTGA[T/A]
GTTAAATGTGGGAAATAAAATTTCCTAAATATAAAGCATGGCTGGATTTAATTTTCATTAACTTCTCCATGGTTAATTATACTCTCTGAAATTTTCCTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.20% | 22.00% | 4.87% | 2.01% | NA |
| All Indica | 2759 | 92.00% | 1.80% | 4.17% | 1.99% | NA |
| All Japonica | 1512 | 26.40% | 64.20% | 7.14% | 2.31% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.80% | 4.40% | 2.35% | 0.50% | NA |
| Indica II | 465 | 90.10% | 1.30% | 6.02% | 2.58% | NA |
| Indica III | 913 | 92.60% | 0.10% | 4.38% | 2.96% | NA |
| Indica Intermediate | 786 | 92.00% | 2.20% | 4.20% | 1.65% | NA |
| Temperate Japonica | 767 | 2.20% | 96.70% | 0.39% | 0.65% | NA |
| Tropical Japonica | 504 | 57.30% | 21.40% | 16.47% | 4.76% | NA |
| Japonica Intermediate | 241 | 38.60% | 49.80% | 9.13% | 2.49% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 2.08% | 4.17% | NA |
| Intermediate | 90 | 74.40% | 18.90% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901967595 | A -> DEL | N | N | silent_mutation | Average:50.402; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0901967595 | A -> T | LOC_Os09g03870.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.402; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901967595 | NA | 3.16E-14 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901967595 | NA | 1.69E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901967595 | 2.13E-06 | NA | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | 2.34E-06 | 9.24E-11 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | 4.06E-07 | NA | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | 4.30E-07 | 2.49E-11 | mr1009 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | NA | 7.28E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | 8.89E-06 | NA | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | 6.09E-06 | 1.51E-07 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | NA | 1.45E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | NA | 6.56E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | NA | 1.55E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | NA | 5.17E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | NA | 2.04E-07 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | NA | 1.49E-10 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901967595 | NA | 4.46E-08 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |