\
| Variant ID: vg0901739971 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1739971 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 259. )
TAAAACCACCTAATGTTGCCTAATTAACCAGCGAAGCATCTACCTAAATTCATACTAGTGGTACCAGGCATAGGGTACCCACTAGTTGGGGGTTTTGTTT[G/A]
TTCTAGGGTGAACAAGGTAATAATAACAATAGCAATAATAAGGTCATATAAAGATAAATAGGCATGGCTAAATAAAACAGTGATAACGCGGGAATTTAAA
TTTAAATTCCCGCGTTATCACTGTTTTATTTAGCCATGCCTATTTATCTTTATATGACCTTATTATTGCTATTGTTATTATTACCTTGTTCACCCTAGAA[C/T]
AAACAAAACCCCCAACTAGTGGGTACCCTATGCCTGGTACCACTAGTATGAATTTAGGTAGATGCTTCGCTGGTTAATTAGGCAACATTAGGTGGTTTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 21.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 35.90% | 64.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.10% | 96.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 79.00% | 21.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901739971 | G -> A | LOC_Os09g03520.1 | upstream_gene_variant ; 2655.0bp to feature; MODIFIER | silent_mutation | Average:34.784; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0901739971 | G -> A | LOC_Os09g03540.1 | upstream_gene_variant ; 775.0bp to feature; MODIFIER | silent_mutation | Average:34.784; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0901739971 | G -> A | LOC_Os09g03530.1 | downstream_gene_variant ; 199.0bp to feature; MODIFIER | silent_mutation | Average:34.784; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0901739971 | G -> A | LOC_Os09g03550.1 | downstream_gene_variant ; 2016.0bp to feature; MODIFIER | silent_mutation | Average:34.784; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0901739971 | G -> A | LOC_Os09g03530-LOC_Os09g03540 | intergenic_region ; MODIFIER | silent_mutation | Average:34.784; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901739971 | NA | 5.03E-37 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901739971 | NA | 2.60E-14 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901739971 | NA | 4.09E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901739971 | NA | 8.08E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | 4.25E-06 | NA | mr1150 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 4.87E-06 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 9.88E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 6.15E-36 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 6.10E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 4.98E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 3.95E-13 | mr1879 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 5.92E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 1.91E-10 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 1.08E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901739971 | NA | 3.63E-18 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |