Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901536604:

Variant ID: vg0901536604 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1536604
Reference Allele: CAlternative Allele: A,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTCCAACCAATGGTCTCTGTTTTGAGAAGATCTAAACTTCCAGTCAGGCCTTACCCACTAGACTTGTGGTTGCACGAAGATGCCTTGCAATAGAGGCC[C/A,G]
GAAGACCGGTCCTTATATTAGCCGGGGTGCGACTACCAAAGTAACTAGCTTAGACCCTGAGCCCAACCCAAAAATATATTTTAGTTGCACAAAGCATTTT

Reverse complement sequence

AAAATGCTTTGTGCAACTAAAATATATTTTTGGGTTGGGCTCAGGGTCTAAGCTAGTTACTTTGGTAGTCGCACCCCGGCTAATATAAGGACCGGTCTTC[G/T,C]
GGCCTCTATTGCAAGGCATCTTCGTGCAACCACAAGTCTAGTGGGTAAGGCCTGACTGGAAGTTTAGATCTTCTCAAAACAGAGACCATTGGTTGGAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.70% 0.50% 0.99% 0.78% G: 0.06%
All Indica  2759 100.00% 0.00% 0.04% 0.00% NA
All Japonica  1512 93.80% 1.30% 2.58% 2.12% G: 0.20%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.10% 0.13% 0.13% NA
Tropical Japonica  504 88.30% 1.20% 4.76% 5.75% NA
Japonica Intermediate  241 87.10% 5.00% 5.81% 0.83% G: 1.24%
VI/Aromatic  96 85.40% 4.20% 6.25% 4.17% NA
Intermediate  90 97.80% 0.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901536604 C -> G LOC_Os09g03200.1 upstream_gene_variant ; 3367.0bp to feature; MODIFIER silent_mutation Average:74.406; most accessible tissue: Zhenshan97 flag leaf, score: 91.557 N N N N
vg0901536604 C -> G LOC_Os09g03190.1 intron_variant ; MODIFIER silent_mutation Average:74.406; most accessible tissue: Zhenshan97 flag leaf, score: 91.557 N N N N
vg0901536604 C -> DEL N N silent_mutation Average:74.406; most accessible tissue: Zhenshan97 flag leaf, score: 91.557 N N N N
vg0901536604 C -> A LOC_Os09g03200.1 upstream_gene_variant ; 3367.0bp to feature; MODIFIER silent_mutation Average:74.406; most accessible tissue: Zhenshan97 flag leaf, score: 91.557 N N N N
vg0901536604 C -> A LOC_Os09g03190.1 intron_variant ; MODIFIER silent_mutation Average:74.406; most accessible tissue: Zhenshan97 flag leaf, score: 91.557 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0901536604 C A 0.01 0.01 0.0 0.0 0.0 0.0
vg0901536604 C G 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901536604 4.45E-06 4.45E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 8.48E-08 8.48E-08 mr1171_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 3.71E-07 3.14E-08 mr1267_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 6.68E-06 6.67E-06 mr1278_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 2.38E-07 2.38E-07 mr1329_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 5.71E-06 5.71E-06 mr1524_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 4.44E-06 4.44E-06 mr1652_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 4.84E-06 4.84E-06 mr1655_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 6.87E-08 6.87E-08 mr1669_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 3.48E-06 3.48E-06 mr1674_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 4.52E-07 4.52E-07 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 NA 7.90E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 3.61E-06 3.61E-06 mr1697_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 6.23E-07 1.79E-07 mr1851_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 2.60E-06 NA mr1864_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901536604 7.89E-07 7.89E-07 mr1982_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251