\
| Variant ID: vg0901482230 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1482230 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.02, others allele: 0.00, population size: 109. )
GCTGGCACAATCTCTATCTTGTCGCCTTGCCATTGAATCAAGCATTGATGCATAGTCAAAGGAATGCAACAATTGGCGTGAATCCAATCCCTTCCAAGCA[C/A]
CAAACTGTACGAACCCTTCCCATCGATGACAAAAAACGTGGTAGGAATAGTCTTACTGCCGACTGTCAGCTCCACATTCAGAACACCTTTGGTTTCCGAT
ATCGGAAACCAAAGGTGTTCTGAATGTGGAGCTGACAGTCGGCAGTAAGACTATTCCTACCACGTTTTTTGTCATCGATGGGAAGGGTTCGTACAGTTTG[G/T]
TGCTTGGAAGGGATTGGATTCACGCCAATTGTTGCATTCCTTTGACTATGCATCAATGCTTGATTCAATGGCAAGGCGACAAGATAGAGATTGTGCCAGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 22.10% | 7.30% | 4.21% | NA |
| All Indica | 2759 | 96.80% | 1.80% | 1.16% | 0.25% | NA |
| All Japonica | 1512 | 7.10% | 64.60% | 16.80% | 11.57% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 94.60% | 4.40% | 1.01% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.60% | 0.10% | 0.66% | 0.66% | NA |
| Indica Intermediate | 786 | 95.20% | 2.30% | 2.42% | 0.13% | NA |
| Temperate Japonica | 767 | 1.70% | 96.90% | 1.17% | 0.26% | NA |
| Tropical Japonica | 504 | 14.90% | 22.20% | 34.52% | 28.37% | NA |
| Japonica Intermediate | 241 | 7.90% | 50.20% | 29.46% | 12.45% | NA |
| VI/Aromatic | 96 | 40.60% | 1.00% | 43.75% | 14.58% | NA |
| Intermediate | 90 | 57.80% | 21.10% | 17.78% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901482230 | C -> DEL | LOC_Os09g03110.1 | N | frameshift_variant | Average:43.448; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | N | N | N | N |
| vg0901482230 | C -> A | LOC_Os09g03110.1 | missense_variant ; p.Val1169Leu; MODERATE | nonsynonymous_codon ; V1169L | Average:43.448; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 | benign |
-1.335 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901482230 | NA | 2.31E-35 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901482230 | NA | 1.90E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901482230 | NA | 5.34E-12 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901482230 | 4.99E-07 | NA | mr1221 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 4.38E-15 | mr1228 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 2.31E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 6.25E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 2.01E-07 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 7.19E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 4.13E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 6.01E-10 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 1.10E-07 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 8.80E-08 | mr1606_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901482230 | NA | 1.51E-18 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |