Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0901409319:

Variant ID: vg0901409319 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 1409319
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.16, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

CGTAACTCAACCACTGTAAGTAAATGTACGAGAGATCGCTACGATTGACTGGTTGAGAACCAGTGAGTAGGTGTCTCTCGATCATTTGAATTCATGGTGC[T/G]
AGGACCGTTGCGCTATTGCTGTAGTCGTACCTCGACCATCTAAGGTTGCGGTGCGAGAGATTGCTACGTACTGGTTCGAGGACCAGCGAACACGCAGAAT

Reverse complement sequence

ATTCTGCGTGTTCGCTGGTCCTCGAACCAGTACGTAGCAATCTCTCGCACCGCAACCTTAGATGGTCGAGGTACGACTACAGCAATAGCGCAACGGTCCT[A/C]
GCACCATGAATTCAAATGATCGAGAGACACCTACTCACTGGTTCTCAACCAGTCAATCGTAGCGATCTCTCGTACATTTACTTACAGTGGTTGAGTTACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.60%	23.80%	2.01%	11.62%	NA
All Indica	2759	94.30%	2.90%	1.59%	1.16%	NA
All Japonica	1512	1.80%	67.10%	0.26%	30.82%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	92.60%	6.40%	0.50%	0.50%	NA
Indica II	465	97.40%	2.40%	0.00%	0.22%	NA
Indica III	913	96.70%	0.20%	1.75%	1.31%	NA
Indica Intermediate	786	91.10%	3.70%	3.18%	2.04%	NA
Temperate Japonica	767	0.80%	97.50%	0.00%	1.69%	NA
Tropical Japonica	504	2.80%	26.80%	0.60%	69.84%	NA
Japonica Intermediate	241	2.90%	54.80%	0.41%	41.91%	NA
VI/Aromatic	96	13.50%	8.30%	42.71%	35.42%	NA
Intermediate	90	52.20%	23.30%	6.67%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0901409319	T -> G	LOC_Os09g02990.1	upstream_gene_variant ; 2492.0bp to feature; MODIFIER	silent_mutation	Average:30.787; most accessible tissue: Zhenshan97 flag leaf, score: 79.247	N	N	N	N
vg0901409319	T -> G	LOC_Os09g03000.1	downstream_gene_variant ; 405.0bp to feature; MODIFIER	silent_mutation	Average:30.787; most accessible tissue: Zhenshan97 flag leaf, score: 79.247	N	N	N	N
vg0901409319	T -> G	LOC_Os09g02990-LOC_Os09g03000	intergenic_region ; MODIFIER	silent_mutation	Average:30.787; most accessible tissue: Zhenshan97 flag leaf, score: 79.247	N	N	N	N
vg0901409319	T -> DEL	N	N	silent_mutation	Average:30.787; most accessible tissue: Zhenshan97 flag leaf, score: 79.247	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0901409319	NA	2.78E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319	NA	4.53E-06	mr1043_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319	NA	9.77E-06	mr1269_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319	NA	3.48E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319	NA	8.39E-08	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319	NA	8.48E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319	NA	8.45E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251