\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901409319:

Variant ID: vg0901409319 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1409319
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, T: 0.16, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


CGTAACTCAACCACTGTAAGTAAATGTACGAGAGATCGCTACGATTGACTGGTTGAGAACCAGTGAGTAGGTGTCTCTCGATCATTTGAATTCATGGTGC[T/G]
AGGACCGTTGCGCTATTGCTGTAGTCGTACCTCGACCATCTAAGGTTGCGGTGCGAGAGATTGCTACGTACTGGTTCGAGGACCAGCGAACACGCAGAAT

Reverse complement sequence

ATTCTGCGTGTTCGCTGGTCCTCGAACCAGTACGTAGCAATCTCTCGCACCGCAACCTTAGATGGTCGAGGTACGACTACAGCAATAGCGCAACGGTCCT[A/C]
GCACCATGAATTCAAATGATCGAGAGACACCTACTCACTGGTTCTCAACCAGTCAATCGTAGCGATCTCTCGTACATTTACTTACAGTGGTTGAGTTACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 23.80% 2.01% 11.62% NA
All Indica  2759 94.30% 2.90% 1.59% 1.16% NA
All Japonica  1512 1.80% 67.10% 0.26% 30.82% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 92.60% 6.40% 0.50% 0.50% NA
Indica II  465 97.40% 2.40% 0.00% 0.22% NA
Indica III  913 96.70% 0.20% 1.75% 1.31% NA
Indica Intermediate  786 91.10% 3.70% 3.18% 2.04% NA
Temperate Japonica  767 0.80% 97.50% 0.00% 1.69% NA
Tropical Japonica  504 2.80% 26.80% 0.60% 69.84% NA
Japonica Intermediate  241 2.90% 54.80% 0.41% 41.91% NA
VI/Aromatic  96 13.50% 8.30% 42.71% 35.42% NA
Intermediate  90 52.20% 23.30% 6.67% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901409319 T -> G LOC_Os09g02990.1 upstream_gene_variant ; 2492.0bp to feature; MODIFIER silent_mutation Average:30.787; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0901409319 T -> G LOC_Os09g03000.1 downstream_gene_variant ; 405.0bp to feature; MODIFIER silent_mutation Average:30.787; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0901409319 T -> G LOC_Os09g02990-LOC_Os09g03000 intergenic_region ; MODIFIER silent_mutation Average:30.787; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N
vg0901409319 T -> DEL N N silent_mutation Average:30.787; most accessible tissue: Zhenshan97 flag leaf, score: 79.247 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901409319 NA 2.78E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319 NA 4.53E-06 mr1043_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319 NA 9.77E-06 mr1269_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319 NA 3.48E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319 NA 8.39E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319 NA 8.48E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901409319 NA 8.45E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251