\
| Variant ID: vg0901034419 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1034419 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTAATCTCTATCGGGCTTGAACTAAGGCCCATCACCGATGACTATTTTTCCATTTTTCCAGATAAGTCTTTATATTTGTGAGTACAAAATATATAACTG[C/T]
TGTATAATAATTCATTTTATTAGTCATAATATATTTTCGGATAGTAAATGATTTCAAATGGAAATATGGTAAACAACAAAGTTGATCCTCTCATCAGGAT
ATCCTGATGAGAGGATCAACTTTGTTGTTTACCATATTTCCATTTGAAATCATTTACTATCCGAAAATATATTATGACTAATAAAATGAATTATTATACA[G/A]
CAGTTATATATTTTGTACTCACAAATATAAAGACTTATCTGGAAAAATGGAAAAATAGTCATCGGTGATGGGCCTTAGTTCAAGCCCGATAGAGATTAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 9.20% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 74.70% | 25.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 37.10% | 62.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 28.10% | 18.75% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 13.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901034419 | C -> T | LOC_Os09g02480.1 | upstream_gene_variant ; 3312.0bp to feature; MODIFIER | silent_mutation | Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0901034419 | C -> T | LOC_Os09g02490.1 | upstream_gene_variant ; 428.0bp to feature; MODIFIER | silent_mutation | Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0901034419 | C -> T | LOC_Os09g02500.1 | downstream_gene_variant ; 1282.0bp to feature; MODIFIER | silent_mutation | Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0901034419 | C -> T | LOC_Os09g02490-LOC_Os09g02500 | intergenic_region ; MODIFIER | silent_mutation | Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901034419 | NA | 5.79E-06 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 9.22E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 2.62E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 4.31E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 2.20E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 4.89E-06 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 4.17E-06 | mr1224_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 2.21E-06 | mr1404_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 9.35E-06 | mr1425_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 3.47E-07 | mr1425_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901034419 | NA | 2.84E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |