\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901034419:

Variant ID: vg0901034419 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1034419
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAATCTCTATCGGGCTTGAACTAAGGCCCATCACCGATGACTATTTTTCCATTTTTCCAGATAAGTCTTTATATTTGTGAGTACAAAATATATAACTG[C/T]
TGTATAATAATTCATTTTATTAGTCATAATATATTTTCGGATAGTAAATGATTTCAAATGGAAATATGGTAAACAACAAAGTTGATCCTCTCATCAGGAT

Reverse complement sequence

ATCCTGATGAGAGGATCAACTTTGTTGTTTACCATATTTCCATTTGAAATCATTTACTATCCGAAAATATATTATGACTAATAAAATGAATTATTATACA[G/A]
CAGTTATATATTTTGTACTCACAAATATAAAGACTTATCTGGAAAAATGGAAAAATAGTCATCGGTGATGGGCCTTAGTTCAAGCCCGATAGAGATTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 9.20% 0.51% 0.00% NA
All Indica  2759 99.40% 0.50% 0.07% 0.00% NA
All Japonica  1512 74.70% 25.30% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 37.10% 62.70% 0.20% 0.00% NA
Japonica Intermediate  241 78.80% 21.20% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 28.10% 18.75% 0.00% NA
Intermediate  90 83.30% 13.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901034419 C -> T LOC_Os09g02480.1 upstream_gene_variant ; 3312.0bp to feature; MODIFIER silent_mutation Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0901034419 C -> T LOC_Os09g02490.1 upstream_gene_variant ; 428.0bp to feature; MODIFIER silent_mutation Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0901034419 C -> T LOC_Os09g02500.1 downstream_gene_variant ; 1282.0bp to feature; MODIFIER silent_mutation Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0901034419 C -> T LOC_Os09g02490-LOC_Os09g02500 intergenic_region ; MODIFIER silent_mutation Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901034419 NA 5.79E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 9.22E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 2.62E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 4.31E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 2.20E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 4.89E-06 mr1155_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 4.17E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 2.21E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 9.35E-06 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 3.47E-07 mr1425_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419 NA 2.84E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251