Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0901034419:

Variant ID: vg0901034419 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 1034419
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAATCTCTATCGGGCTTGAACTAAGGCCCATCACCGATGACTATTTTTCCATTTTTCCAGATAAGTCTTTATATTTGTGAGTACAAAATATATAACTG[C/T]
TGTATAATAATTCATTTTATTAGTCATAATATATTTTCGGATAGTAAATGATTTCAAATGGAAATATGGTAAACAACAAAGTTGATCCTCTCATCAGGAT

Reverse complement sequence

ATCCTGATGAGAGGATCAACTTTGTTGTTTACCATATTTCCATTTGAAATCATTTACTATCCGAAAATATATTATGACTAATAAAATGAATTATTATACA[G/A]
CAGTTATATATTTTGTACTCACAAATATAAAGACTTATCTGGAAAAATGGAAAAATAGTCATCGGTGATGGGCCTTAGTTCAAGCCCGATAGAGATTAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.30%	9.20%	0.51%	0.00%	NA
All Indica	2759	99.40%	0.50%	0.07%	0.00%	NA
All Japonica	1512	74.70%	25.30%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	99.00%	0.90%	0.13%	0.00%	NA
Temperate Japonica	767	98.00%	2.00%	0.00%	0.00%	NA
Tropical Japonica	504	37.10%	62.70%	0.20%	0.00%	NA
Japonica Intermediate	241	78.80%	21.20%	0.00%	0.00%	NA
VI/Aromatic	96	53.10%	28.10%	18.75%	0.00%	NA
Intermediate	90	83.30%	13.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0901034419	C -> T	LOC_Os09g02480.1	upstream_gene_variant ; 3312.0bp to feature; MODIFIER	silent_mutation	Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0901034419	C -> T	LOC_Os09g02490.1	upstream_gene_variant ; 428.0bp to feature; MODIFIER	silent_mutation	Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0901034419	C -> T	LOC_Os09g02500.1	downstream_gene_variant ; 1282.0bp to feature; MODIFIER	silent_mutation	Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N
vg0901034419	C -> T	LOC_Os09g02490-LOC_Os09g02500	intergenic_region ; MODIFIER	silent_mutation	Average:29.245; most accessible tissue: Zhenshan97 root, score: 51.776	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0901034419	NA	5.79E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	9.22E-07	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	2.62E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	4.31E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	2.20E-07	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	4.89E-06	mr1155_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	4.17E-06	mr1224_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	2.21E-06	mr1404_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	9.35E-06	mr1425_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	3.47E-07	mr1425_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901034419	NA	2.84E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251