Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0900901867:

Variant ID: vg0900901867 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 901867
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.17, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCTTAAATTTTAGCTAATCCCTTCTATACCCCTGAATTTCGCTTCCTTCCTTGTATACCCCTACAATTTGATTTTGATCCCTTCCATACCCCTCTCAT[T/C]
AGTTGACCGTCTAATTTCTATAAAAATGACCATTTTACCCTTTGGATAAACATAGAAAATCATGAATTACATTATTAAAAACATAAAGTTTGTCGCATGA

Reverse complement sequence

TCATGCGACAAACTTTATGTTTTTAATAATGTAATTCATGATTTTCTATGTTTATCCAAAGGGTAAAATGGTCATTTTTATAGAAATTAGACGGTCAACT[A/G]
ATGAGAGGGGTATGGAAGGGATCAAAATCAAATTGTAGGGGTATACAAGGAAGGAAGCGAAATTCAGGGGTATAGAAGGGATTAGCTAAAATTTAAGGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 35.40% 0.13% 0.00% NA
All Indica  2759 95.50% 4.30% 0.18% 0.00% NA
All Japonica  1512 1.30% 98.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.30% 5.50% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 96.30% 3.50% 0.22% 0.00% NA
Indica Intermediate  786 93.80% 6.00% 0.25% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900901867 T -> C LOC_Os09g02250.1 upstream_gene_variant ; 4751.0bp to feature; MODIFIER silent_mutation Average:49.07; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0900901867 T -> C LOC_Os09g02250.2 upstream_gene_variant ; 4751.0bp to feature; MODIFIER silent_mutation Average:49.07; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0900901867 T -> C LOC_Os09g02240.1 downstream_gene_variant ; 725.0bp to feature; MODIFIER silent_mutation Average:49.07; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0900901867 T -> C LOC_Os09g02240-LOC_Os09g02250 intergenic_region ; MODIFIER silent_mutation Average:49.07; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900901867 NA 6.52E-23 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 4.44E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 4.25E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 9.96E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 2.63E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 9.10E-06 9.10E-06 mr1126_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 1.53E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 3.39E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 2.04E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 3.06E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 5.87E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 1.84E-06 1.84E-06 mr1405_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 8.53E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 7.03E-06 7.03E-06 mr1516_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 4.31E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 5.93E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 4.35E-07 4.35E-07 mr1680_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 3.76E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 3.12E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 3.52E-06 2.52E-06 mr1726_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 5.72E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 1.06E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 1.63E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 2.36E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 4.38E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 6.49E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 8.62E-06 8.61E-06 mr1981_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900901867 NA 7.71E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251