\
| Variant ID: vg0900825661 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 825661 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTCGACACGGGTGATAACCAGAGGAGACGTGGTGCTGCGATTGCGGGGCTCAAGAGCGTGCACGTTCAAGAAGCCGGATCGATTTGTGTCGTGACTCCG[C/T]
CCAAATCGTTGTTTATCAGAACCTTTCGGAAGATCGGGAACTGTGGACCCCCGTTTTTATAACAAGAATCATTCGTGTAAACAGTATCATTTCCCTGGAT
ATCCAGGGAAATGATACTGTTTACACGAATGATTCTTGTTATAAAAACGGGGGTCCACAGTTCCCGATCTTCCGAAAGGTTCTGATAAACAACGATTTGG[G/A]
CGGAGTCACGACACAAATCGATCCGGCTTCTTGAACGTGCACGCTCTTGAGCCCCGCAATCGCAGCACCACGTCTCCTCTGGTTATCACCCGTGTCGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 7.70% | 1.08% | 0.00% | NA |
| All Indica | 2759 | 92.80% | 5.90% | 1.30% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 23.00% | 71.70% | 5.20% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 87.70% | 6.70% | 5.59% | 0.00% | NA |
| Indica III | 913 | 94.30% | 5.60% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 88.80% | 10.10% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900825661 | C -> T | LOC_Os09g02140.1 | downstream_gene_variant ; 2891.0bp to feature; MODIFIER | silent_mutation | Average:31.07; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| vg0900825661 | C -> T | LOC_Os09g02140-LOC_Os09g02150 | intergenic_region ; MODIFIER | silent_mutation | Average:31.07; most accessible tissue: Zhenshan97 root, score: 55.432 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900825661 | NA | 6.39E-16 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | NA | 1.28E-20 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | NA | 2.21E-20 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | NA | 1.78E-16 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | NA | 1.84E-15 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | NA | 9.67E-07 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 3.67E-07 | 2.45E-23 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 1.04E-07 | 1.96E-24 | mr1114_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 1.95E-07 | 3.18E-25 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 6.07E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 6.93E-07 | 2.65E-23 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | NA | 3.73E-22 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 7.15E-06 | 1.05E-23 | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 1.01E-06 | 7.50E-23 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 1.64E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 3.14E-06 | 1.59E-25 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | 5.89E-07 | 2.58E-17 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900825661 | NA | 3.90E-15 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |