\
| Variant ID: vg0900381058 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 381058 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 77. )
GAAGTATGACGGCACCACTAACCCCGAATCGTGGCTTACCGTCTACGGTCTCGCAATCCGTGCAGCAGGAGGAGACAACAAGGCCATGGCGAATTATTTA[C/T]
CGGTGGCTTTAGCAGATTCCGCCCGATCTTGGCTCCATGGATTGCCCCGTGGTACAATTGGATCTTGGGCCGAACTACGCGACCACTTCATCGCCAACTT
AAGTTGGCGATGAAGTGGTCGCGTAGTTCGGCCCAAGATCCAATTGTACCACGGGGCAATCCATGGAGCCAAGATCGGGCGGAATCTGCTAAAGCCACCG[G/A]
TAAATAATTCGCCATGGCCTTGTTGTCTCCTCCTGCTGCACGGATTGCGAGACCGTAGACGGTAAGCCACGATTCGGGGTTAGTGGTGCCGTCATACTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.40% | 5.50% | 6.90% | 56.12% | NA |
| All Indica | 2759 | 12.50% | 0.30% | 6.27% | 80.94% | NA |
| All Japonica | 1512 | 68.30% | 15.90% | 6.55% | 9.19% | NA |
| Aus | 269 | 3.70% | 0.00% | 17.84% | 78.44% | NA |
| Indica I | 595 | 17.00% | 0.20% | 3.19% | 79.66% | NA |
| Indica II | 465 | 25.40% | 0.20% | 6.88% | 67.53% | NA |
| Indica III | 913 | 3.40% | 0.20% | 6.24% | 90.14% | NA |
| Indica Intermediate | 786 | 12.10% | 0.50% | 8.27% | 79.13% | NA |
| Temperate Japonica | 767 | 76.40% | 0.50% | 7.95% | 15.12% | NA |
| Tropical Japonica | 504 | 50.40% | 43.10% | 5.56% | 0.99% | NA |
| Japonica Intermediate | 241 | 80.10% | 8.30% | 4.15% | 7.47% | NA |
| VI/Aromatic | 96 | 46.90% | 0.00% | 2.08% | 51.04% | NA |
| Intermediate | 90 | 58.90% | 14.40% | 4.44% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900381058 | C -> DEL | LOC_Os09g01530.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0900381058 | C -> T | LOC_Os09g01530.1 | missense_variant ; p.Pro436Ser; MODERATE | nonsynonymous_codon ; P436S | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
0.945 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900381058 | 3.75E-08 | NA | Grain_weight | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0900381058 | NA | 1.72E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 8.08E-10 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 7.89E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 1.34E-09 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 2.41E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 2.99E-07 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 9.53E-07 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 5.71E-06 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 1.51E-13 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 5.36E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900381058 | NA | 2.94E-07 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |