\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900044105:

Variant ID: vg0900044105 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 44105
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TAATGATTTTAGTTGACTTGAACTATGGATTCCGATAATTGTTTCCATCGGCTGCTCTTCCAGATGAGTGAACCATGTTAATGGGAAAAGGATTGCCATT[G/A,T]
ACCTTCATCGGCTTCTTGGAATCATCAAACTTGATTTTGCCCCCCTCAATAGCCAACTGGATCTGTTGTCTAAAAACCTTAGTCATTAGTACAAAGAGAG

Reverse complement sequence

CTCTCTTTGTACTAATGACTAAGGTTTTTAGACAACAGATCCAGTTGGCTATTGAGGGGGGCAAAATCAAGTTTGATGATTCCAAGAAGCCGATGAAGGT[C/T,A]
AATGGCAATCCTTTTCCCATTAACATGGTTCACTCATCTGGAAGAGCAGCCGATGGAAACAATTATCGGAATCCATAGTTCAAGTCAACTAAAATCATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 28.80% 3.43% 11.89% A: 0.17%
All Indica  2759 38.10% 45.80% 3.77% 12.11% A: 0.22%
All Japonica  1512 86.80% 0.30% 1.52% 11.31% A: 0.07%
Aus  269 66.90% 32.00% 0.00% 1.12% NA
Indica I  595 47.90% 41.00% 2.35% 8.74% NA
Indica II  465 47.10% 24.10% 7.53% 21.29% NA
Indica III  913 30.60% 56.30% 3.29% 9.31% A: 0.55%
Indica Intermediate  786 34.20% 50.00% 3.18% 12.47% A: 0.13%
Temperate Japonica  767 75.60% 0.10% 2.61% 21.64% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 96.30% 0.80% 1.24% 1.24% A: 0.41%
VI/Aromatic  96 20.80% 4.20% 27.08% 46.88% A: 1.04%
Intermediate  90 73.30% 6.70% 10.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900044105 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900044105 G -> T LOC_Os09g01002.1 upstream_gene_variant ; 2447.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900044105 G -> T LOC_Os09g01006.1 downstream_gene_variant ; 747.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900044105 G -> T LOC_Os09g01006-LOC_Os09g01010 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900044105 G -> A LOC_Os09g01002.1 upstream_gene_variant ; 2447.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900044105 G -> A LOC_Os09g01006.1 downstream_gene_variant ; 747.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900044105 G -> A LOC_Os09g01006-LOC_Os09g01010 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0900044105 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01
vg0900044105 G T -0.01 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900044105 4.93E-06 NA mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900044105 1.36E-06 8.80E-08 mr1168 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900044105 9.35E-07 7.69E-08 mr1383 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900044105 NA 2.09E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900044105 3.55E-06 3.55E-06 mr1449 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900044105 NA 1.93E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900044105 6.05E-06 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900044105 1.66E-06 1.72E-09 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900044105 NA 7.24E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251