\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828200030:

Variant ID: vg0828200030 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 28200030
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGATGCAGCACTAAGTATGAAAAGAAACATAATATCTAGACAATCAAGCCGTTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAATCTAG[T/C]
AACGCGATTTAGCCGATACCGGCAGAAACCCTAAAACGAGAAGCAGCCGATAGAGCTAAATTGACATGCTAAGACTAGATTAACAGAAACATATGATAAA

Reverse complement sequence

TTTATCATATGTTTCTGTTAATCTAGTCTTAGCATGTCAATTTAGCTCTATCGGCTGCTTCTCGTTTTAGGGTTTCTGCCGGTATCGGCTAAATCGCGTT[A/G]
CTAGATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAACGGCTTGATTGTCTAGATATTATGTTTCTTTTCATACTTAGTGCTGCATCAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 2.80% 37.52% 23.61% NA
All Indica  2759 3.40% 2.30% 57.12% 37.11% NA
All Japonica  1512 97.50% 0.10% 0.93% 1.46% NA
Aus  269 2.20% 20.80% 55.02% 21.93% NA
Indica I  595 4.00% 0.30% 22.52% 73.11% NA
Indica II  465 2.80% 1.50% 54.19% 41.51% NA
Indica III  913 2.50% 3.80% 82.48% 11.17% NA
Indica Intermediate  786 4.50% 2.50% 55.60% 37.40% NA
Temperate Japonica  767 97.50% 0.10% 0.91% 1.43% NA
Tropical Japonica  504 97.80% 0.20% 0.79% 1.19% NA
Japonica Intermediate  241 96.70% 0.00% 1.24% 2.07% NA
VI/Aromatic  96 92.70% 6.20% 1.04% 0.00% NA
Intermediate  90 44.40% 5.60% 37.78% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0828200030 T -> C LOC_Os08g44900.1 upstream_gene_variant ; 2900.0bp to feature; MODIFIER silent_mutation Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0828200030 T -> C LOC_Os08g44910.1 downstream_gene_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0828200030 T -> C LOC_Os08g44920.1 downstream_gene_variant ; 4680.0bp to feature; MODIFIER silent_mutation Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0828200030 T -> C LOC_Os08g44900-LOC_Os08g44910 intergenic_region ; MODIFIER silent_mutation Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0828200030 T -> DEL N N silent_mutation Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0828200030 NA 1.42E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 6.78E-06 6.78E-06 mr1187 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.25E-16 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.45E-20 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.83E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 7.32E-06 NA mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.64E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 4.21E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 3.98E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.61E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 5.37E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 5.03E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 6.96E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 2.48E-16 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 2.54E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 5.75E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 3.42E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 4.23E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 4.68E-07 4.68E-07 mr1545 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 3.28E-10 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.84E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 4.28E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 6.52E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 3.96E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 8.59E-28 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.00E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 3.67E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 5.83E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 5.83E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.66E-28 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 3.56E-13 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 1.26E-07 8.93E-08 mr1942 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.08E-08 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 1.04E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030 NA 3.25E-06 mr1871_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251