Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828200030:

Variant ID: vg0828200030 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 28200030
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTGATGCAGCACTAAGTATGAAAAGAAACATAATATCTAGACAATCAAGCCGTTGACTGAGTTTTCAGGGTGGTAGATGTCTAAGCTAATCTAATCTAG[T/C]
AACGCGATTTAGCCGATACCGGCAGAAACCCTAAAACGAGAAGCAGCCGATAGAGCTAAATTGACATGCTAAGACTAGATTAACAGAAACATATGATAAA

Reverse complement sequence

TTTATCATATGTTTCTGTTAATCTAGTCTTAGCATGTCAATTTAGCTCTATCGGCTGCTTCTCGTTTTAGGGTTTCTGCCGGTATCGGCTAAATCGCGTT[A/G]
CTAGATTAGATTAGCTTAGACATCTACCACCCTGAAAACTCAGTCAACGGCTTGATTGTCTAGATATTATGTTTCTTTTCATACTTAGTGCTGCATCAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.10%	2.80%	37.52%	23.61%	NA
All Indica	2759	3.40%	2.30%	57.12%	37.11%	NA
All Japonica	1512	97.50%	0.10%	0.93%	1.46%	NA
Aus	269	2.20%	20.80%	55.02%	21.93%	NA
Indica I	595	4.00%	0.30%	22.52%	73.11%	NA
Indica II	465	2.80%	1.50%	54.19%	41.51%	NA
Indica III	913	2.50%	3.80%	82.48%	11.17%	NA
Indica Intermediate	786	4.50%	2.50%	55.60%	37.40%	NA
Temperate Japonica	767	97.50%	0.10%	0.91%	1.43%	NA
Tropical Japonica	504	97.80%	0.20%	0.79%	1.19%	NA
Japonica Intermediate	241	96.70%	0.00%	1.24%	2.07%	NA
VI/Aromatic	96	92.70%	6.20%	1.04%	0.00%	NA
Intermediate	90	44.40%	5.60%	37.78%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0828200030	T -> C	LOC_Os08g44900.1	upstream_gene_variant ; 2900.0bp to feature; MODIFIER	silent_mutation	Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0828200030	T -> C	LOC_Os08g44910.1	downstream_gene_variant ; 994.0bp to feature; MODIFIER	silent_mutation	Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0828200030	T -> C	LOC_Os08g44920.1	downstream_gene_variant ; 4680.0bp to feature; MODIFIER	silent_mutation	Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0828200030	T -> C	LOC_Os08g44900-LOC_Os08g44910	intergenic_region ; MODIFIER	silent_mutation	Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N
vg0828200030	T -> DEL	N	N	silent_mutation	Average:8.828; most accessible tissue: Minghui63 panicle, score: 16.27	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0828200030	NA	1.42E-25	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	6.78E-06	6.78E-06	mr1187	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.25E-16	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.45E-20	mr1254	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.83E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	7.32E-06	NA	mr1320	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.64E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	4.21E-16	mr1323	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	3.98E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.61E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	5.37E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	5.03E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	6.96E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	2.48E-16	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	2.54E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	5.75E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	3.42E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	4.23E-07	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	4.68E-07	4.68E-07	mr1545	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	3.28E-10	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.84E-13	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	4.28E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	6.52E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	3.96E-14	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	8.59E-28	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.00E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	3.67E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	5.83E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	5.83E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.66E-28	mr1922	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	3.56E-13	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	1.26E-07	8.93E-08	mr1942	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.08E-08	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	1.04E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828200030	NA	3.25E-06	mr1871_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251