\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827871012:

Variant ID: vg0827871012 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27871012
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTATTTTTAATATCAAATTTTTGTTATTTGTAAATTATATATATTCCTATATGGACTCTAGACTCGTCTTTTAATATTTCTTTTTTTAAATTCTGAA[T/A]
TTTTATTATTTCTAATTGTATTTCTATGTGGTCTCTAAACTCATCTTTCAATATTCTTTAATTTTTAATTTTAAATTTCAGTTACTTCTAAATTGTATTC

Reverse complement sequence

GAATACAATTTAGAAGTAACTGAAATTTAAAATTAAAAATTAAAGAATATTGAAAGATGAGTTTAGAGACCACATAGAAATACAATTAGAAATAATAAAA[A/T]
TTCAGAATTTAAAAAAAGAAATATTAAAAGACGAGTCTAGAGTCCATATAGGAATATATATAATTTACAAATAACAAAAATTTGATATTAAAAATAATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.20% 0.36% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 76.90% 22.00% 1.12% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 96.90% 2.60% 0.52% 0.00% NA
Tropical Japonica  504 42.70% 55.00% 2.38% 0.00% NA
Japonica Intermediate  241 85.10% 14.50% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827871012 T -> A LOC_Os08g44260.1 upstream_gene_variant ; 2695.0bp to feature; MODIFIER silent_mutation Average:50.659; most accessible tissue: Callus, score: 74.72 N N N N
vg0827871012 T -> A LOC_Os08g44270.1 upstream_gene_variant ; 4130.0bp to feature; MODIFIER silent_mutation Average:50.659; most accessible tissue: Callus, score: 74.72 N N N N
vg0827871012 T -> A LOC_Os08g44260.2 upstream_gene_variant ; 2695.0bp to feature; MODIFIER silent_mutation Average:50.659; most accessible tissue: Callus, score: 74.72 N N N N
vg0827871012 T -> A LOC_Os08g44260-LOC_Os08g44270 intergenic_region ; MODIFIER silent_mutation Average:50.659; most accessible tissue: Callus, score: 74.72 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827871012 4.49E-06 8.65E-11 mr1518 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827871012 NA 3.48E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827871012 NA 6.64E-28 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827871012 NA 1.26E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827871012 NA 5.09E-15 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827871012 NA 3.48E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827871012 NA 4.79E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827871012 NA 6.16E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827871012 NA 3.87E-15 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827871012 NA 1.82E-17 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251