Variant ID: vg0827871012 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 27871012 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAATTATTTTTAATATCAAATTTTTGTTATTTGTAAATTATATATATTCCTATATGGACTCTAGACTCGTCTTTTAATATTTCTTTTTTTAAATTCTGAA[T/A]
TTTTATTATTTCTAATTGTATTTCTATGTGGTCTCTAAACTCATCTTTCAATATTCTTTAATTTTTAATTTTAAATTTCAGTTACTTCTAAATTGTATTC
GAATACAATTTAGAAGTAACTGAAATTTAAAATTAAAAATTAAAGAATATTGAAAGATGAGTTTAGAGACCACATAGAAATACAATTAGAAATAATAAAA[A/T]
TTCAGAATTTAAAAAAAGAAATATTAAAAGACGAGTCTAGAGTCCATATAGGAATATATATAATTTACAAATAACAAAAATTTGATATTAAAAATAATTA
Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.50% | 7.20% | 0.36% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 76.90% | 22.00% | 1.12% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 96.90% | 2.60% | 0.52% | 0.00% | NA |
Tropical Japonica | 504 | 42.70% | 55.00% | 2.38% | 0.00% | NA |
Japonica Intermediate | 241 | 85.10% | 14.50% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0827871012 | T -> A | LOC_Os08g44260.1 | upstream_gene_variant ; 2695.0bp to feature; MODIFIER | silent_mutation | Average:50.659; most accessible tissue: Callus, score: 74.72 | N | N | N | N |
vg0827871012 | T -> A | LOC_Os08g44270.1 | upstream_gene_variant ; 4130.0bp to feature; MODIFIER | silent_mutation | Average:50.659; most accessible tissue: Callus, score: 74.72 | N | N | N | N |
vg0827871012 | T -> A | LOC_Os08g44260.2 | upstream_gene_variant ; 2695.0bp to feature; MODIFIER | silent_mutation | Average:50.659; most accessible tissue: Callus, score: 74.72 | N | N | N | N |
vg0827871012 | T -> A | LOC_Os08g44260-LOC_Os08g44270 | intergenic_region ; MODIFIER | silent_mutation | Average:50.659; most accessible tissue: Callus, score: 74.72 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0827871012 | 4.49E-06 | 8.65E-11 | mr1518 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0827871012 | NA | 3.48E-10 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0827871012 | NA | 6.64E-28 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0827871012 | NA | 1.26E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0827871012 | NA | 5.09E-15 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0827871012 | NA | 3.48E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0827871012 | NA | 4.79E-06 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0827871012 | NA | 6.16E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0827871012 | NA | 3.87E-15 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0827871012 | NA | 1.82E-17 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |