\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827664904:

Variant ID: vg0827664904 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27664904
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGAGGGGCGAACCTATAGCCCCAAGTTATTTTTTTCTGCAAACAAATTGCATATGCTATCAGCATAAATAATACTCAAGGTTAAGGCAGAGAGAAAAG[C/A]
TCCCAGATCAACAAGTAGAGAATGTAATGTTATGGGAAAGAGAGAAAAATGAGGCGCTCACCGGCCGGCGGCGAGGACGCCGGCGCCGCTGGTCGCGAGA

Reverse complement sequence

TCTCGCGACCAGCGGCGCCGGCGTCCTCGCCGCCGGCCGGTGAGCGCCTCATTTTTCTCTCTTTCCCATAACATTACATTCTCTACTTGTTGATCTGGGA[G/T]
CTTTTCTCTCTGCCTTAACCTTGAGTATTATTTATGCTGATAGCATATGCAATTTGTTTGCAGAAAAAAATAACTTGGGGCTATAGGTTCGCCCCTCTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.70% 8.60% 0.68% 0.00% NA
All Indica  2759 99.90% 0.00% 0.04% 0.00% NA
All Japonica  1512 72.00% 26.20% 1.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 96.30% 2.60% 1.04% 0.00% NA
Tropical Japonica  504 28.60% 68.50% 2.98% 0.00% NA
Japonica Intermediate  241 85.50% 12.90% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 11.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827664904 C -> A LOC_Os08g43815.1 upstream_gene_variant ; 3819.0bp to feature; MODIFIER silent_mutation Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188 N N N N
vg0827664904 C -> A LOC_Os08g43840.1 upstream_gene_variant ; 438.0bp to feature; MODIFIER silent_mutation Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188 N N N N
vg0827664904 C -> A LOC_Os08g43850.1 upstream_gene_variant ; 49.0bp to feature; MODIFIER silent_mutation Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188 N N N N
vg0827664904 C -> A LOC_Os08g43860.1 upstream_gene_variant ; 3432.0bp to feature; MODIFIER silent_mutation Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188 N N N N
vg0827664904 C -> A LOC_Os08g43840-LOC_Os08g43850 intergenic_region ; MODIFIER silent_mutation Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827664904 NA 5.36E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0827664904 NA 1.34E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 4.32E-07 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 7.83E-06 4.72E-08 mr1388 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 5.89E-06 mr1388 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 6.12E-07 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 1.17E-06 mr1398 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 2.16E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 1.31E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 8.23E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 8.62E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 3.38E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 4.66E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 7.55E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 4.50E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 2.03E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 3.14E-11 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 3.61E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 3.48E-32 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 2.69E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904 NA 2.73E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251