Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827664904:

Variant ID: vg0827664904 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 27664904
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CCAGAGGGGCGAACCTATAGCCCCAAGTTATTTTTTTCTGCAAACAAATTGCATATGCTATCAGCATAAATAATACTCAAGGTTAAGGCAGAGAGAAAAG[C/A]
TCCCAGATCAACAAGTAGAGAATGTAATGTTATGGGAAAGAGAGAAAAATGAGGCGCTCACCGGCCGGCGGCGAGGACGCCGGCGCCGCTGGTCGCGAGA

Reverse complement sequence

TCTCGCGACCAGCGGCGCCGGCGTCCTCGCCGCCGGCCGGTGAGCGCCTCATTTTTCTCTCTTTCCCATAACATTACATTCTCTACTTGTTGATCTGGGA[G/T]
CTTTTCTCTCTGCCTTAACCTTGAGTATTATTTATGCTGATAGCATATGCAATTTGTTTGCAGAAAAAAATAACTTGGGGCTATAGGTTCGCCCCTCTGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.70%	8.60%	0.68%	0.00%	NA
All Indica	2759	99.90%	0.00%	0.04%	0.00%	NA
All Japonica	1512	72.00%	26.20%	1.79%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	96.30%	2.60%	1.04%	0.00%	NA
Tropical Japonica	504	28.60%	68.50%	2.98%	0.00%	NA
Japonica Intermediate	241	85.50%	12.90%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	11.10%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0827664904	C -> A	LOC_Os08g43815.1	upstream_gene_variant ; 3819.0bp to feature; MODIFIER	silent_mutation	Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188	N	N	N	N
vg0827664904	C -> A	LOC_Os08g43840.1	upstream_gene_variant ; 438.0bp to feature; MODIFIER	silent_mutation	Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188	N	N	N	N
vg0827664904	C -> A	LOC_Os08g43850.1	upstream_gene_variant ; 49.0bp to feature; MODIFIER	silent_mutation	Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188	N	N	N	N
vg0827664904	C -> A	LOC_Os08g43860.1	upstream_gene_variant ; 3432.0bp to feature; MODIFIER	silent_mutation	Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188	N	N	N	N
vg0827664904	C -> A	LOC_Os08g43840-LOC_Os08g43850	intergenic_region ; MODIFIER	silent_mutation	Average:56.409; most accessible tissue: Zhenshan97 root, score: 72.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0827664904	NA	5.36E-12	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0827664904	NA	1.34E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	4.32E-07	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	7.83E-06	4.72E-08	mr1388	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	5.89E-06	mr1388	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	6.12E-07	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	1.17E-06	mr1398	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	2.16E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	1.31E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	8.23E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	8.62E-07	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	3.38E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	4.66E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	7.55E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	4.50E-07	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	2.03E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	3.14E-11	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	3.61E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	3.48E-32	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	2.69E-12	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827664904	NA	2.73E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251