Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0827096536:

Variant ID: vg0827096536 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 27096536
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAGATATCCTCAGGTTCAAAAGTTACTATATGGTGCCCTAATTACCGTCAGGAAATTATCTCACTACTTTCAAAGTCACCCGGTCACGGTAGTCACAT[C/T]
GTTTCCACTCGGGGATATACTTCACAATCGCGAAGCAAATGGACGGATCGCGAAGTGGGCCTTAGAGTTGATGTATTTGGACATATCGTTCAAGCCACGA

Reverse complement sequence

TCGTGGCTTGAACGATATGTCCAAATACATCAACTCTAAGGCCCACTTCGCGATCCGTCCATTTGCTTCGCGATTGTGAAGTATATCCCCGAGTGGAAAC[G/A]
ATGTGACTACCGTGACCGGGTGACTTTGAAAGTAGTGAGATAATTTCCTGACGGTAATTAGGGCACCATATAGTAACTTTTGAACCTGAGGATATCTTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	24.80%	1.99%	0.87%	NA
All Indica	2759	58.60%	38.30%	1.67%	1.45%	NA
All Japonica	1512	98.20%	1.70%	0.00%	0.07%	NA
Aus	269	57.20%	24.90%	17.84%	0.00%	NA
Indica I	595	38.30%	55.30%	5.21%	1.18%	NA
Indica II	465	54.00%	46.00%	0.00%	0.00%	NA
Indica III	913	70.20%	26.00%	0.88%	2.96%	NA
Indica Intermediate	786	63.10%	35.20%	0.89%	0.76%	NA
Temperate Japonica	767	97.90%	2.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.00%	0.00%	0.20%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0827096536	C -> T	LOC_Os08g42850.4	downstream_gene_variant ; 3181.0bp to feature; MODIFIER	silent_mutation	Average:15.733; most accessible tissue: Callus, score: 20.853	N	N	N	N
vg0827096536	C -> T	LOC_Os08g42860.1	downstream_gene_variant ; 2245.0bp to feature; MODIFIER	silent_mutation	Average:15.733; most accessible tissue: Callus, score: 20.853	N	N	N	N
vg0827096536	C -> T	LOC_Os08g42850.2	downstream_gene_variant ; 4029.0bp to feature; MODIFIER	silent_mutation	Average:15.733; most accessible tissue: Callus, score: 20.853	N	N	N	N
vg0827096536	C -> T	LOC_Os08g42850.1	downstream_gene_variant ; 3181.0bp to feature; MODIFIER	silent_mutation	Average:15.733; most accessible tissue: Callus, score: 20.853	N	N	N	N
vg0827096536	C -> T	LOC_Os08g42850.3	downstream_gene_variant ; 3181.0bp to feature; MODIFIER	silent_mutation	Average:15.733; most accessible tissue: Callus, score: 20.853	N	N	N	N
vg0827096536	C -> T	LOC_Os08g42850-LOC_Os08g42860	intergenic_region ; MODIFIER	silent_mutation	Average:15.733; most accessible tissue: Callus, score: 20.853	N	N	N	N
vg0827096536	C -> DEL	N	N	silent_mutation	Average:15.733; most accessible tissue: Callus, score: 20.853	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0827096536	NA	5.83E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536	5.98E-06	5.98E-06	mr1348	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536	NA	5.65E-12	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536	NA	2.64E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536	NA	6.01E-06	mr1533	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536	7.31E-06	7.30E-06	mr1996	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536	NA	3.04E-06	mr1348_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536	NA	6.56E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536	NA	8.32E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251