\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827096536:

Variant ID: vg0827096536 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27096536
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGATATCCTCAGGTTCAAAAGTTACTATATGGTGCCCTAATTACCGTCAGGAAATTATCTCACTACTTTCAAAGTCACCCGGTCACGGTAGTCACAT[C/T]
GTTTCCACTCGGGGATATACTTCACAATCGCGAAGCAAATGGACGGATCGCGAAGTGGGCCTTAGAGTTGATGTATTTGGACATATCGTTCAAGCCACGA

Reverse complement sequence

TCGTGGCTTGAACGATATGTCCAAATACATCAACTCTAAGGCCCACTTCGCGATCCGTCCATTTGCTTCGCGATTGTGAAGTATATCCCCGAGTGGAAAC[G/A]
ATGTGACTACCGTGACCGGGTGACTTTGAAAGTAGTGAGATAATTTCCTGACGGTAATTAGGGCACCATATAGTAACTTTTGAACCTGAGGATATCTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 24.80% 1.99% 0.87% NA
All Indica  2759 58.60% 38.30% 1.67% 1.45% NA
All Japonica  1512 98.20% 1.70% 0.00% 0.07% NA
Aus  269 57.20% 24.90% 17.84% 0.00% NA
Indica I  595 38.30% 55.30% 5.21% 1.18% NA
Indica II  465 54.00% 46.00% 0.00% 0.00% NA
Indica III  913 70.20% 26.00% 0.88% 2.96% NA
Indica Intermediate  786 63.10% 35.20% 0.89% 0.76% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.00% 0.00% 0.20% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827096536 C -> T LOC_Os08g42850.4 downstream_gene_variant ; 3181.0bp to feature; MODIFIER silent_mutation Average:15.733; most accessible tissue: Callus, score: 20.853 N N N N
vg0827096536 C -> T LOC_Os08g42860.1 downstream_gene_variant ; 2245.0bp to feature; MODIFIER silent_mutation Average:15.733; most accessible tissue: Callus, score: 20.853 N N N N
vg0827096536 C -> T LOC_Os08g42850.2 downstream_gene_variant ; 4029.0bp to feature; MODIFIER silent_mutation Average:15.733; most accessible tissue: Callus, score: 20.853 N N N N
vg0827096536 C -> T LOC_Os08g42850.1 downstream_gene_variant ; 3181.0bp to feature; MODIFIER silent_mutation Average:15.733; most accessible tissue: Callus, score: 20.853 N N N N
vg0827096536 C -> T LOC_Os08g42850.3 downstream_gene_variant ; 3181.0bp to feature; MODIFIER silent_mutation Average:15.733; most accessible tissue: Callus, score: 20.853 N N N N
vg0827096536 C -> T LOC_Os08g42850-LOC_Os08g42860 intergenic_region ; MODIFIER silent_mutation Average:15.733; most accessible tissue: Callus, score: 20.853 N N N N
vg0827096536 C -> DEL N N silent_mutation Average:15.733; most accessible tissue: Callus, score: 20.853 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827096536 NA 5.83E-07 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536 5.98E-06 5.98E-06 mr1348 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536 NA 5.65E-12 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536 NA 2.64E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536 NA 6.01E-06 mr1533 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536 7.31E-06 7.30E-06 mr1996 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536 NA 3.04E-06 mr1348_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536 NA 6.56E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827096536 NA 8.32E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251