\
| Variant ID: vg0827077651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 27077651 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTCCTCTATCTATCAAAACTGGTGCAAACAATGTCCCTCGGTGGTTTTGGCTGACGTGGCGCCTACATGGCGGTTTTGACCGAGTCTTTGTCCTATGTG[A/G]
TGCTTACGTGGCATTAGAAAAAACAAAAATAAAAAAATATGTGGGACCCCTATGTCATTCACACACACAAAAAAAGTATTGTGGGACCCACATGTCATCC
GGATGACATGTGGGTCCCACAATACTTTTTTTGTGTGTGTGAATGACATAGGGGTCCCACATATTTTTTTATTTTTGTTTTTTCTAATGCCACGTAAGCA[T/C]
CACATAGGACAAAGACTCGGTCAAAACCGCCATGTAGGCGCCACGTCAGCCAAAACCACCGAGGGACATTGTTTGCACCAGTTTTGATAGATAGAGGAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.10% | 33.40% | 0.19% | 21.31% | NA |
| All Indica | 2759 | 64.90% | 0.90% | 0.25% | 34.00% | NA |
| All Japonica | 1512 | 4.30% | 95.00% | 0.07% | 0.60% | NA |
| Aus | 269 | 84.40% | 0.40% | 0.00% | 15.24% | NA |
| Indica I | 595 | 71.60% | 0.80% | 0.00% | 27.56% | NA |
| Indica II | 465 | 64.30% | 0.40% | 0.22% | 35.05% | NA |
| Indica III | 913 | 63.50% | 0.40% | 0.33% | 35.71% | NA |
| Indica Intermediate | 786 | 61.70% | 1.70% | 0.38% | 36.26% | NA |
| Temperate Japonica | 767 | 2.30% | 96.90% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 7.50% | 92.10% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 3.70% | 95.40% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 11.50% | 83.30% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 41.10% | 42.20% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0827077651 | A -> G | LOC_Os08g42810.1 | upstream_gene_variant ; 2323.0bp to feature; MODIFIER | silent_mutation | Average:66.841; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0827077651 | A -> G | LOC_Os08g42830.1 | downstream_gene_variant ; 3034.0bp to feature; MODIFIER | silent_mutation | Average:66.841; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0827077651 | A -> G | LOC_Os08g42820.1 | intron_variant ; MODIFIER | silent_mutation | Average:66.841; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0827077651 | A -> DEL | N | N | silent_mutation | Average:66.841; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0827077651 | NA | 5.76E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827077651 | NA | 9.48E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827077651 | NA | 1.92E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827077651 | NA | 1.52E-15 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827077651 | NA | 7.69E-06 | mr1857 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827077651 | NA | 1.33E-06 | mr1881 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827077651 | NA | 1.02E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |